EMAIL THIS PAGE TO A FRIEND

CYP4B1

cytochrome P450, family 4, subfamily B, polypeptide 1

104 Gene Product Result for
Synonyms: CYPIVB1 P-450HP
UniProtKB ID: P13584, Q1HBI2, Q8TD85, Q8WWF2, Q8WWU9, Q8WWV0
Gene ID:
Human(1580) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. In rodents, the homologous protein has been shown to metabolize certain carcinogens; however, the specific function of the human protein has not been determined. Two transcript variants encoding slightly different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(13120) cytochrome P450, family 4, subfamily b, polypeptide 1
Rat(24307) cytochrome P450, family 4, subfamily b, polypeptide 1
chicken(424618) cytochrome P450, family 4, subfamily B, polypeptide 1
dog(608452) cytochrome P450, family 4, subfamily B, polypeptide 1
cow(540149) cytochrome P450, family 4, subfamily B, polypeptide 1
Domestic Rabbit(100008805) CYP4B1-like isozyme short form
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000779 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000779 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000779 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007823 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007823 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007823 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU003971 MISSION® esiRNA esiRNA targeting human CYP4B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000779 Rosetta Predictions human pricing
NM_001099772 Rosetta Predictions human pricing
NM_016999 Rosetta Predictions rat pricing
NM_007823 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000779 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152310 predicted 1347
2 SASI_Hs02_00303206 predicted 1371
3 SASI_Hs01_00152311 predicted 1041
4 SASI_Hs02_00303207 predicted 1481
5 SASI_Hs02_00303208 predicted 1280
6 SASI_Hs02_00303209 predicted 1542
7 SASI_Hs02_00303210 predicted 1401
8 SASI_Hs02_00303211 predicted 1014
9 SASI_Hs01_00152312 predicted 1168
10 SASI_Hs02_00303212 predicted 1567
11 SASI_Hs01_00152309 predicted 496
12 SASI_Hs01_00152313 predicted 532
13 SASI_Hs01_00152314 predicted 297
14 SASI_Hs01_00152315 predicted 539
15 SASI_Hs01_00152316 predicted 522
16 SASI_Hs01_00152317 predicted 1386
17 SASI_Hs01_00152318 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321378 predicted 1349
2 SASI_Hs02_00321379 predicted 1375
3 SASI_Hs02_00321380 predicted 1044
4 SASI_Hs02_00321381 predicted 1482
5 SASI_Hs02_00321382 predicted 1291
6 SASI_Hs02_00321383 predicted 1544
7 SASI_Hs02_00321384 predicted 1398
8 SASI_Hs02_00321385 predicted 1016
9 SASI_Hs02_00321386 predicted 1176
10 SASI_Hs02_00321387 predicted 1569
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261144 predicted 524
2 SASI_Rn01_00052430 predicted 474
3 SASI_Rn02_00261145 predicted 1524
4 SASI_Rn01_00052431 predicted 1583
5 SASI_Rn01_00052432 predicted 240
6 SASI_Rn01_00052433 predicted 257
7 SASI_Rn01_00052434 predicted 459
8 SASI_Rn01_00052435 predicted 1364
9 SASI_Rn01_00052436 predicted 699
10 SASI_Rn01_00052437 predicted 993
11 SASI_Rn01_00052438 predicted 1270
12 SASI_Rn01_00052439 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007823 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056967 predicted 768
2 SASI_Mm01_00056970 predicted 479
3 SASI_Mm01_00056973 predicted 779
4 SASI_Mm01_00056975 predicted 628
5 SASI_Mm01_00056976 predicted 718
6 SASI_Mm02_00312547 predicted 299
7 SASI_Mm02_00312548 predicted 1189
8 SASI_Mm02_00312549 predicted 699
9 SASI_Mm02_00312550 predicted 658
10 SASI_Mm02_00312551 predicted 760
11 SASI_Mm01_00056968 predicted 1365
12 SASI_Mm01_00056969 predicted 1545
13 SASI_Mm01_00056971 predicted 1553
14 SASI_Mm01_00056972 predicted 1293
15 SASI_Mm01_00056974 predicted 1638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000779
CYP4B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-345s1c1
Sequence:CCGGCCCTGATGTGTATGACTTCTTCTCGAGAAGAAGTCATACACATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-889s1c1
Sequence:CCGGCGGGATGAAGATGACATCAAACTCGAGTTTGATGTCATCTTCATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1221s1c1
Sequence:CCGGCCTGATCTCTATGCATATCTACTCGAGTAGATATGCATAGAGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-81s1c1
Sequence:CCGGCTTAGGCTTTCTCAAGCTCATCTCGAGATGAGCTTGAGAAAGCCTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1383s1c1
Sequence:CCGGGTTTGCCATGAGTGAGATGAACTCGAGTTCATCTCACTCATGGCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000779
CYP4B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-345s1c1
Sequence:CCGGCCCTGATGTGTATGACTTCTTCTCGAGAAGAAGTCATACACATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-889s1c1
Sequence:CCGGCGGGATGAAGATGACATCAAACTCGAGTTTGATGTCATCTTCATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1221s1c1
Sequence:CCGGCCTGATCTCTATGCATATCTACTCGAGTAGATATGCATAGAGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-81s1c1
Sequence:CCGGCTTAGGCTTTCTCAAGCTCATCTCGAGATGAGCTTGAGAAAGCCTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1383s1c1
Sequence:CCGGGTTTGCCATGAGTGAGATGAACTCGAGTTCATCTCACTCATGGCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000779
CYP4B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily B, polypeptide 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-345s1c1
Sequence:CCGGCCCTGATGTGTATGACTTCTTCTCGAGAAGAAGTCATACACATCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-889s1c1
Sequence:CCGGCGGGATGAAGATGACATCAAACTCGAGTTTGATGTCATCTTCATCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1221s1c1
Sequence:CCGGCCTGATCTCTATGCATATCTACTCGAGTAGATATGCATAGAGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-81s1c1
Sequence:CCGGCTTAGGCTTTCTCAAGCTCATCTCGAGATGAGCTTGAGAAAGCCTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000779.2-1383s1c1
Sequence:CCGGGTTTGCCATGAGTGAGATGAACTCGAGTTCATCTCACTCATGGCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007823
CYP4B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007823.1-1685s1c1
Sequence:CCGGGCCTGGGCTTTCAAACTCATTCTCGAGAATGAGTTTGAAAGCCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-706s1c1
Sequence:CCGGCAGTACCATAATGACTTCATTCTCGAGAATGAAGTCATTATGGTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-775s1c1
Sequence:CCGGGCCCATGACCATACAGATCATCTCGAGATGATCTGTATGGTCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-705s1c1
Sequence:CCGGCCAGTACCATAATGACTTCATCTCGAGATGAAGTCATTATGGTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-532s1c1
Sequence:CCGGGCTAGTGAGAATAAGAGCTTTCTCGAGAAAGCTCTTATTCTCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007823
CYP4B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007823.1-1685s1c1
Sequence:CCGGGCCTGGGCTTTCAAACTCATTCTCGAGAATGAGTTTGAAAGCCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-706s1c1
Sequence:CCGGCAGTACCATAATGACTTCATTCTCGAGAATGAAGTCATTATGGTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-775s1c1
Sequence:CCGGGCCCATGACCATACAGATCATCTCGAGATGATCTGTATGGTCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-705s1c1
Sequence:CCGGCCAGTACCATAATGACTTCATCTCGAGATGAAGTCATTATGGTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-532s1c1
Sequence:CCGGGCTAGTGAGAATAAGAGCTTTCTCGAGAAAGCTCTTATTCTCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007823
CYP4B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126059    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007823.1-1685s1c1
Sequence:CCGGGCCTGGGCTTTCAAACTCATTCTCGAGAATGAGTTTGAAAGCCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-706s1c1
Sequence:CCGGCAGTACCATAATGACTTCATTCTCGAGAATGAAGTCATTATGGTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-775s1c1
Sequence:CCGGGCCCATGACCATACAGATCATCTCGAGATGATCTGTATGGTCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-705s1c1
Sequence:CCGGCCAGTACCATAATGACTTCATCTCGAGATGAAGTCATTATGGTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007823.1-532s1c1
Sequence:CCGGGCTAGTGAGAATAAGAGCTTTCTCGAGAAAGCTCTTATTCTCACTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)