EMAIL THIS PAGE TO A FRIEND

CYP4F11

cytochrome P450, family 4, subfamily F, polypeptide 11

21 Gene Product Result for
Synonyms: CYPIVF11
Species: Human CYP4F11(57834)
UniProtKB ID: Q9HBI6, O75254, Q96AQ5
Gene ID:
Human(57834) Summary: This gene, CYP4F11, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F2, is approximately 16 kb away. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021187 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148111 MISSION® esiRNA esiRNA human CYP4F11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134749 predicted 1600
2 SASI_Hs01_00134750 predicted 1698
3 SASI_Hs01_00134752 predicted 950
4 SASI_Hs01_00134753 predicted 944
5 SASI_Hs01_00134754 predicted 810
6 SASI_Hs01_00134755 predicted 416
7 SASI_Hs01_00134756 predicted 416
8 SASI_Hs01_00134757 predicted 1199
9 SASI_Hs01_00134758 predicted 1301
10 SASI_Hs02_00354757 predicted 320
11 SASI_Hs01_00134751 predicted 1169
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021187
CYP4F11 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1437s1c1
Sequence:CCGGCCGTTTCAACCAAGAGAACATCTCGAGATGTTCTCTTGGTTGAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1368s1c1
Sequence:CCGGCCTTATCAATATTATCGGGATCTCGAGATCCCGATAATATTGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1603s1c1
Sequence:CCGGCGCAGGAAACCCGAGCTGATACTCGAGTATCAGCTCGGGTTTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-457s1c1
Sequence:CCGGGTCGCACCCAAGGATATGATTCTCGAGAATCATATCCTTGGGTGCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-667s1c1
Sequence:CCGGGCCAGACTGGACATGTTTGAACTCGAGTTCAAACATGTCCAGTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1657s21c1
Sequence:CCGGGATGTTGCACGCAGGACTTTGCTCGAGCAAAGTCCTGCGTGCAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1724s21c1
Sequence:CCGGCAATATTATCGGGATCCATTACTCGAGTAATGGATCCCGATAATATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021187
CYP4F11 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1437s1c1
Sequence:CCGGCCGTTTCAACCAAGAGAACATCTCGAGATGTTCTCTTGGTTGAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1368s1c1
Sequence:CCGGCCTTATCAATATTATCGGGATCTCGAGATCCCGATAATATTGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1603s1c1
Sequence:CCGGCGCAGGAAACCCGAGCTGATACTCGAGTATCAGCTCGGGTTTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-457s1c1
Sequence:CCGGGTCGCACCCAAGGATATGATTCTCGAGAATCATATCCTTGGGTGCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-667s1c1
Sequence:CCGGGCCAGACTGGACATGTTTGAACTCGAGTTCAAACATGTCCAGTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1657s21c1
Sequence:CCGGGATGTTGCACGCAGGACTTTGCTCGAGCAAAGTCCTGCGTGCAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1724s21c1
Sequence:CCGGCAATATTATCGGGATCCATTACTCGAGTAATGGATCCCGATAATATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021187
CYP4F11 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1437s1c1
Sequence:CCGGCCGTTTCAACCAAGAGAACATCTCGAGATGTTCTCTTGGTTGAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1368s1c1
Sequence:CCGGCCTTATCAATATTATCGGGATCTCGAGATCCCGATAATATTGATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-1603s1c1
Sequence:CCGGCGCAGGAAACCCGAGCTGATACTCGAGTATCAGCTCGGGTTTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-457s1c1
Sequence:CCGGGTCGCACCCAAGGATATGATTCTCGAGAATCATATCCTTGGGTGCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021187.1-667s1c1
Sequence:CCGGGCCAGACTGGACATGTTTGAACTCGAGTTCAAACATGTCCAGTCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1657s21c1
Sequence:CCGGGATGTTGCACGCAGGACTTTGCTCGAGCAAAGTCCTGCGTGCAACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021187.3-1724s21c1
Sequence:CCGGCAATATTATCGGGATCCATTACTCGAGTAATGGATCCCGATAATATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)