EMAIL THIS PAGE TO A FRIEND

CYP4F12

cytochrome P450, family 4, subfamily F, polypeptide 12

21 Gene Product Result for
Synonyms: F22329_1
Species: Human CYP4F12(66002)
UniProtKB ID: Q9HCS2, O60389, Q9HCS1
Gene ID:
Human(66002) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid; however, its physiological function has not been determined. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023944 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023944 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023944 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111471 MISSION® esiRNA esiRNA human CYP4F12 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023944 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023944 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198389 predicted 272
2 SASI_Hs01_00198390 predicted 782
3 SASI_Hs01_00198391 predicted 303
4 SASI_Hs01_00198392 predicted 989
5 SASI_Hs01_00198393 predicted 1309
6 SASI_Hs01_00198394 predicted 1303
7 SASI_Hs01_00198395 predicted 287
8 SASI_Hs01_00198396 predicted 564
9 SASI_Hs01_00198397 predicted 993
10 SASI_Hs01_00198398 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023944
CYP4F12 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 12
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-166s21c1
Sequence:CCGGGGCTTGGACCTATGCCTTCTACTCGAGTAGAAGGCATAGGTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-1614s21c1
Sequence:CCGGCCCTGAATGTAGGCTTGCAGTCTCGAGACTGCAAGCCTACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-377s21c1
Sequence:CCGGACCATCCGGTCTATCACCAATCTCGAGATTGGTGATAGACCGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-376s1c1
Sequence:CCGGGCCATTGCACCCAAGGATAATCTCGAGATTATCCTTGGGTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1124s1c1
Sequence:CCGGGCGATCCTAAAGAGATTGAATCTCGAGATTCAATCTCTTTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-524s1c1
Sequence:CCGGCGATCTTCAACAAGAGTGCAACTCGAGTTGCACTCTTGTTGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-964s1c1
Sequence:CCGGGCATTGTCAGATGAGGATATACTCGAGTATATCCTCATCTGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1524s1c1
Sequence:CCGGCCGCAGGAAGCTGGAATTGATCTCGAGATCAATTCCAGCTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023944
CYP4F12 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 12
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-166s21c1
Sequence:CCGGGGCTTGGACCTATGCCTTCTACTCGAGTAGAAGGCATAGGTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-1614s21c1
Sequence:CCGGCCCTGAATGTAGGCTTGCAGTCTCGAGACTGCAAGCCTACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-377s21c1
Sequence:CCGGACCATCCGGTCTATCACCAATCTCGAGATTGGTGATAGACCGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-376s1c1
Sequence:CCGGGCCATTGCACCCAAGGATAATCTCGAGATTATCCTTGGGTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1124s1c1
Sequence:CCGGGCGATCCTAAAGAGATTGAATCTCGAGATTCAATCTCTTTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-524s1c1
Sequence:CCGGCGATCTTCAACAAGAGTGCAACTCGAGTTGCACTCTTGTTGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-964s1c1
Sequence:CCGGGCATTGTCAGATGAGGATATACTCGAGTATATCCTCATCTGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1524s1c1
Sequence:CCGGCCGCAGGAAGCTGGAATTGATCTCGAGATCAATTCCAGCTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023944
CYP4F12 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 12
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-166s21c1
Sequence:CCGGGGCTTGGACCTATGCCTTCTACTCGAGTAGAAGGCATAGGTCCAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-1614s21c1
Sequence:CCGGCCCTGAATGTAGGCTTGCAGTCTCGAGACTGCAAGCCTACATTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023944.2-377s21c1
Sequence:CCGGACCATCCGGTCTATCACCAATCTCGAGATTGGTGATAGACCGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-376s1c1
Sequence:CCGGGCCATTGCACCCAAGGATAATCTCGAGATTATCCTTGGGTGCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1124s1c1
Sequence:CCGGGCGATCCTAAAGAGATTGAATCTCGAGATTCAATCTCTTTAGGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-524s1c1
Sequence:CCGGCGATCTTCAACAAGAGTGCAACTCGAGTTGCACTCTTGTTGAAGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-964s1c1
Sequence:CCGGGCATTGTCAGATGAGGATATACTCGAGTATATCCTCATCTGACAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023944.1-1524s1c1
Sequence:CCGGCCGCAGGAAGCTGGAATTGATCTCGAGATCAATTCCAGCTTCCTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks