EMAIL THIS PAGE TO A FRIEND

CYP4F22

cytochrome P450, family 4, subfamily F, polypeptide 22

38 Gene Product Result for
Synonyms: ARCI5 INLNE LI3
UniProtKB ID: Q6NT55, Q8N8H4
Gene ID:
Human(126410) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19 and encodes an enzyme thought to play a role in the 12(R)-lipoxygenase pathway. Mutations in this gene are the cause of ichthyosis lamellar type 3. [provided by RefSeq, Jul 2008]
chicken(100859277) cytochrome P450, family 4, subfamily F, polypeptide 22
dog(484868) cytochrome P450, family 4, subfamily F, polypeptide 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173483 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173483 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173483 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130231 MISSION® esiRNA esiRNA human CYP4F22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173483 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173483 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239223 predicted 1631
2 SASI_Hs01_00239224 predicted 840
3 SASI_Hs01_00239225 predicted 1320
4 SASI_Hs01_00239226 predicted 1316
5 SASI_Hs01_00239227 predicted 1317
6 SASI_Hs01_00239228 predicted 443
7 SASI_Hs01_00239229 predicted 1213
8 SASI_Hs01_00239230 predicted 704
9 SASI_Hs01_00239231 predicted 1827
10 SASI_Hs01_00239232 predicted 382
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173483
VALIDATED
CYP4F22 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 22
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173483.1-1322s1c1
Sequence:CCGGGCCCTTTACAACTATGTGCATCTCGAGATGCACATAGTTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-701s1c1
Sequence:CCGGCGCTGACATTATGCATGCTAACTCGAGTTAGCATGCATAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-546s1c1
Sequence:CCGGCCCAAGGATGACCTCTTCTATCTCGAGATAGAAGAGGTCATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-1209s1c1
Sequence:CCGGCTGTTCAATTTGGCAAAGTATCTCGAGATACTTTGCCAAATTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-754s1c1
Sequence:CCGGCCCTTGATATGTTTGAGCATACTCGAGTATGCTCAAACATATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-212s21c1
Sequence:CCGGGAAGACGGCGTTCCGCATATACTCGAGTATATGCGGAACGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-850s21c1
Sequence:CCGGATTATATCTCCGCTATCATTGCTCGAGCAATGATAGCGGAGATATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-1373s21c1
Sequence:CCGGCACTCTTGTCTCTCGCCAATGCTCGAGCATTGGCGAGAGACAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173483
VALIDATED
CYP4F22 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 22
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173483.1-1322s1c1
Sequence:CCGGGCCCTTTACAACTATGTGCATCTCGAGATGCACATAGTTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-701s1c1
Sequence:CCGGCGCTGACATTATGCATGCTAACTCGAGTTAGCATGCATAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-546s1c1
Sequence:CCGGCCCAAGGATGACCTCTTCTATCTCGAGATAGAAGAGGTCATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-1209s1c1
Sequence:CCGGCTGTTCAATTTGGCAAAGTATCTCGAGATACTTTGCCAAATTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-754s1c1
Sequence:CCGGCCCTTGATATGTTTGAGCATACTCGAGTATGCTCAAACATATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-212s21c1
Sequence:CCGGGAAGACGGCGTTCCGCATATACTCGAGTATATGCGGAACGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-850s21c1
Sequence:CCGGATTATATCTCCGCTATCATTGCTCGAGCAATGATAGCGGAGATATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-1373s21c1
Sequence:CCGGCACTCTTGTCTCTCGCCAATGCTCGAGCATTGGCGAGAGACAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173483
VALIDATED
CYP4F22 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 22
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_173483.1-1322s1c1
Sequence:CCGGGCCCTTTACAACTATGTGCATCTCGAGATGCACATAGTTGTAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-701s1c1
Sequence:CCGGCGCTGACATTATGCATGCTAACTCGAGTTAGCATGCATAATGTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-546s1c1
Sequence:CCGGCCCAAGGATGACCTCTTCTATCTCGAGATAGAAGAGGTCATCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-1209s1c1
Sequence:CCGGCTGTTCAATTTGGCAAAGTATCTCGAGATACTTTGCCAAATTGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173483.1-754s1c1
Sequence:CCGGCCCTTGATATGTTTGAGCATACTCGAGTATGCTCAAACATATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-212s21c1
Sequence:CCGGGAAGACGGCGTTCCGCATATACTCGAGTATATGCGGAACGCCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-850s21c1
Sequence:CCGGATTATATCTCCGCTATCATTGCTCGAGCAATGATAGCGGAGATATAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173483.3-1373s21c1
Sequence:CCGGCACTCTTGTCTCTCGCCAATGCTCGAGCATTGGCGAGAGACAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks