EMAIL THIS PAGE TO A FRIEND

CYP4F2

cytochrome P450, family 4, subfamily F, polypeptide 2

23 Gene Product Result for
Synonyms: CPF2
Gene ID:
Human(8529) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F11, is approximately 16 kb away. [provided by RefSeq, Jul 2008]
cow(507016) cytochrome P450, family 4, subfamily F, polypeptide 2
cow(507615) cytochrome P450, family 4, subfamily F, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001082 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001082 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001082 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001082 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001082 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094227 predicted 754
2 SASI_Hs01_00094219 predicted 981
3 SASI_Hs01_00094220 predicted 766
4 SASI_Hs01_00094221 predicted 767
5 SASI_Hs01_00094223 predicted 767
6 SASI_Hs01_00094225 predicted 1231
7 SASI_Hs01_00094222 predicted 609
8 SASI_Hs01_00094224 predicted 971
9 SASI_Hs01_00094226 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001082
CYP4F2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-928s21c1
Sequence:CCGGCCAAGACTTTGGACTTCATTGCTCGAGCAATGAAGTCCAAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-2091s21c1
Sequence:CCGGGAGCGACTGCTAATCAGTATGCTCGAGCATACTGATTAGCAGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-1668s21c1
Sequence:CCGGTGAAGCCTAGAATTACCCTAACTCGAGTTAGGGTAATTCTAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-695s21c1
Sequence:CCGGGGAGAAACCCAGTGAATATATCTCGAGATATATTCACTGGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1079s21c1
Sequence:CCGGCCTTGCAAAGCACCCAGAATACTCGAGTATTCTGGGTGCTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-366s21c1
Sequence:CCGGATCATCCGGTCTGTCATCAACCTCGAGGTTGATGACAGACCGGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1180s21c1
Sequence:CCGGATTTGCCCTTCCTGACCATGTCTCGAGACATGGTCAGGAAGGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1007s21c1
Sequence:CCGGAGCAGAAGCTGACACCTTTATCTCGAGATAAAGGTGTCAGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-773s1c1
Sequence:CCGGGCATATTGACTTCCTGTATTACTCGAGTAATACAGGAAGTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-305s1c1
Sequence:CCGGCCAGGGCTTTAAGGTCTGGATCTCGAGATCCAGACCTTAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-759s1c1
Sequence:CCGGCATGAGATCCTCCTGCATATTCTCGAGAATATGCAGGAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-606s1c1
Sequence:CCGGAGTGCCTGTTTGGATATGTTTCTCGAGAAACATATCCAAACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-975s1c1
Sequence:CCGGGACGGGAAGAAGTTATCTGATCTCGAGATCAGATAACTTCTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001082
CYP4F2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-928s21c1
Sequence:CCGGCCAAGACTTTGGACTTCATTGCTCGAGCAATGAAGTCCAAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-2091s21c1
Sequence:CCGGGAGCGACTGCTAATCAGTATGCTCGAGCATACTGATTAGCAGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-1668s21c1
Sequence:CCGGTGAAGCCTAGAATTACCCTAACTCGAGTTAGGGTAATTCTAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-695s21c1
Sequence:CCGGGGAGAAACCCAGTGAATATATCTCGAGATATATTCACTGGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1079s21c1
Sequence:CCGGCCTTGCAAAGCACCCAGAATACTCGAGTATTCTGGGTGCTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-366s21c1
Sequence:CCGGATCATCCGGTCTGTCATCAACCTCGAGGTTGATGACAGACCGGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1180s21c1
Sequence:CCGGATTTGCCCTTCCTGACCATGTCTCGAGACATGGTCAGGAAGGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1007s21c1
Sequence:CCGGAGCAGAAGCTGACACCTTTATCTCGAGATAAAGGTGTCAGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-773s1c1
Sequence:CCGGGCATATTGACTTCCTGTATTACTCGAGTAATACAGGAAGTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-305s1c1
Sequence:CCGGCCAGGGCTTTAAGGTCTGGATCTCGAGATCCAGACCTTAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-759s1c1
Sequence:CCGGCATGAGATCCTCCTGCATATTCTCGAGAATATGCAGGAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-606s1c1
Sequence:CCGGAGTGCCTGTTTGGATATGTTTCTCGAGAAACATATCCAAACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-975s1c1
Sequence:CCGGGACGGGAAGAAGTTATCTGATCTCGAGATCAGATAACTTCTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001082
CYP4F2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-928s21c1
Sequence:CCGGCCAAGACTTTGGACTTCATTGCTCGAGCAATGAAGTCCAAAGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416150    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-2091s21c1
Sequence:CCGGGAGCGACTGCTAATCAGTATGCTCGAGCATACTGATTAGCAGTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001082.3-1668s21c1
Sequence:CCGGTGAAGCCTAGAATTACCCTAACTCGAGTTAGGGTAATTCTAGGCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-695s21c1
Sequence:CCGGGGAGAAACCCAGTGAATATATCTCGAGATATATTCACTGGGTTTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1079s21c1
Sequence:CCGGCCTTGCAAAGCACCCAGAATACTCGAGTATTCTGGGTGCTTTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-366s21c1
Sequence:CCGGATCATCCGGTCTGTCATCAACCTCGAGGTTGATGACAGACCGGATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1180s21c1
Sequence:CCGGATTTGCCCTTCCTGACCATGTCTCGAGACATGGTCAGGAAGGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001082.3-1007s21c1
Sequence:CCGGAGCAGAAGCTGACACCTTTATCTCGAGATAAAGGTGTCAGCTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-773s1c1
Sequence:CCGGGCATATTGACTTCCTGTATTACTCGAGTAATACAGGAAGTCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-305s1c1
Sequence:CCGGCCAGGGCTTTAAGGTCTGGATCTCGAGATCCAGACCTTAAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-759s1c1
Sequence:CCGGCATGAGATCCTCCTGCATATTCTCGAGAATATGCAGGAGGATCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-606s1c1
Sequence:CCGGAGTGCCTGTTTGGATATGTTTCTCGAGAAACATATCCAAACAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001082.3-975s1c1
Sequence:CCGGGACGGGAAGAAGTTATCTGATCTCGAGATCAGATAACTTCTTCCCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks