EMAIL THIS PAGE TO A FRIEND

CYP4F3

cytochrome P450, family 4, subfamily F, polypeptide 3

101 Gene Product Result for
Synonyms: CPF3 CYP4F LTB4H
Species: Human CYP4F3(4051), Zebrafish cyp4f3(100037390)
UniProtKB ID: Q08477, B7Z8Z3, O60634, Q5U740
Gene ID:
Human(4051) Summary: This gene, CYP4F3, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. The enzyme starts the process of inactivating and degrading leukotriene B4, a potent mediator of inflammation. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F8, is approximately 18 kb away. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Zebrafish(100037390) cytochrome P450, family 4, subfamily F, polypeptide 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000896 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000896 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000896 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000896 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303454 predicted 290
2 SASI_Hs02_00303455 predicted 760
3 SASI_Hs02_00303456 predicted 290
4 SASI_Hs02_00303457 predicted 751
5 SASI_Hs02_00303458 predicted 254
6 SASI_Hs01_00232142 predicted 211
7 SASI_Hs02_00303459 predicted 234
8 SASI_Hs02_00303460 predicted 251
9 SASI_Hs01_00232144 predicted 972
10 SASI_Hs01_00232143 predicted 761
11 SASI_Hs01_00232145 predicted 300
12 SASI_Hs01_00232146 predicted 771
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000896
CYP4F3 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-335s21c1
Sequence:CCGGGCACGCAATCGTCCGCATCTTCTCGAGAAGATGCGGACGATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-290s21c1
Sequence:CCGGGGCATGCACCTTCGGTGATATCTCGAGATATCACCGAAGGTGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-606s21c1
Sequence:CCGGAGTGCCCGTCTGGACATGTTTCTCGAGAAACATGTCCAGACGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-1259s21c1
Sequence:CCGGCCAAGACATTGTGCTCCCAGACTCGAGTCTGGGAGCACAATGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-773s1c1
Sequence:CCGGGTACATAGACTTCCTGTATTACTCGAGTAATACAGGAAGTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-256s1c1
Sequence:CCGGGCTCGGAGGAAGGTCTCCTATCTCGAGATAGGAGACCTTCCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-212s1c1
Sequence:CCGGCCCGAAACGGAATTGGTTCTTCTCGAGAAGAACCAATTCCGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-365s1c1
Sequence:CCGGCTACATCAAGCCTGTGCTCTTCTCGAGAAGAGCACAGGCTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000896
CYP4F3 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-335s21c1
Sequence:CCGGGCACGCAATCGTCCGCATCTTCTCGAGAAGATGCGGACGATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-290s21c1
Sequence:CCGGGGCATGCACCTTCGGTGATATCTCGAGATATCACCGAAGGTGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-606s21c1
Sequence:CCGGAGTGCCCGTCTGGACATGTTTCTCGAGAAACATGTCCAGACGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-1259s21c1
Sequence:CCGGCCAAGACATTGTGCTCCCAGACTCGAGTCTGGGAGCACAATGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-773s1c1
Sequence:CCGGGTACATAGACTTCCTGTATTACTCGAGTAATACAGGAAGTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-256s1c1
Sequence:CCGGGCTCGGAGGAAGGTCTCCTATCTCGAGATAGGAGACCTTCCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-212s1c1
Sequence:CCGGCCCGAAACGGAATTGGTTCTTCTCGAGAAGAACCAATTCCGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-365s1c1
Sequence:CCGGCTACATCAAGCCTGTGCTCTTCTCGAGAAGAGCACAGGCTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000896
CYP4F3 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-335s21c1
Sequence:CCGGGCACGCAATCGTCCGCATCTTCTCGAGAAGATGCGGACGATTGCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-290s21c1
Sequence:CCGGGGCATGCACCTTCGGTGATATCTCGAGATATCACCGAAGGTGCATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-606s21c1
Sequence:CCGGAGTGCCCGTCTGGACATGTTTCTCGAGAAACATGTCCAGACGGGCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000896.2-1259s21c1
Sequence:CCGGCCAAGACATTGTGCTCCCAGACTCGAGTCTGGGAGCACAATGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-773s1c1
Sequence:CCGGGTACATAGACTTCCTGTATTACTCGAGTAATACAGGAAGTCTATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-256s1c1
Sequence:CCGGGCTCGGAGGAAGGTCTCCTATCTCGAGATAGGAGACCTTCCTCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-212s1c1
Sequence:CCGGCCCGAAACGGAATTGGTTCTTCTCGAGAAGAACCAATTCCGTTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000896.1-365s1c1
Sequence:CCGGCTACATCAAGCCTGTGCTCTTCTCGAGAAGAGCACAGGCTTGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks