EMAIL THIS PAGE TO A FRIEND

CYP4F8

cytochrome P450, family 4, subfamily F, polypeptide 8

26 Gene Product Result for
Synonyms: CPF8 CYPIVF8
Species: Human CYP4F8(11283)
UniProtKB ID: P98187
Gene ID:
Human(11283) Summary: This gene, CYP4F8, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and functions as a 19-hydroxylase of prostaglandins in seminal vesicles. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F3, is approximately 18 kb away. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007253 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007253 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115579 predicted 409
2 SASI_Hs01_00115580 predicted 365
3 SASI_Hs02_00343278 predicted 1680
4 SASI_Hs01_00115581 predicted 744
5 SASI_Hs01_00115582 predicted 710
6 SASI_Hs01_00115583 predicted 1588
7 SASI_Hs01_00115584 predicted 785
8 SASI_Hs01_00115585 predicted 1646
9 SASI_Hs01_00115587 predicted 750
10 SASI_Hs01_00115588 predicted 406
11 SASI_Hs01_00115586 predicted 1254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007253
CYP4F8 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily F, polypeptide 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007253.3-464s21c1
Sequence:CCGGGATGGGCTCTTGTTAAGTGTTCTCGAGAACACTTAACAAGAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007253.3-1685s21c1
Sequence:CCGGTTTCAGATTTCCGGTAATAAACTCGAGTTTATTACCGGAAATCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-695s1c1
Sequence:CCGGGCCCTTGTAGTGAAACGGAATCTCGAGATTCCGTTTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-353s1c1
Sequence:CCGGGCCATTACAGACAAGGACATACTCGAGTATGTCCTTGTCTGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1252s1c1
Sequence:CCGGCAAAGGGAATGTCTGTAACATCTCGAGATGTTACAGACATTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1276s1c1
Sequence:CCGGCATCTTCGCAATCCATCACAACTCGAGTTGTGATGGATTGCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-169s1c1
Sequence:CCGGCCGGAAACAGAACTGGTTCTTCTCGAGAAGAACCAGTTCTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007253
CYP4F8 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily F, polypeptide 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007253.3-464s21c1
Sequence:CCGGGATGGGCTCTTGTTAAGTGTTCTCGAGAACACTTAACAAGAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007253.3-1685s21c1
Sequence:CCGGTTTCAGATTTCCGGTAATAAACTCGAGTTTATTACCGGAAATCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-695s1c1
Sequence:CCGGGCCCTTGTAGTGAAACGGAATCTCGAGATTCCGTTTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-353s1c1
Sequence:CCGGGCCATTACAGACAAGGACATACTCGAGTATGTCCTTGTCTGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1252s1c1
Sequence:CCGGCAAAGGGAATGTCTGTAACATCTCGAGATGTTACAGACATTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1276s1c1
Sequence:CCGGCATCTTCGCAATCCATCACAACTCGAGTTGTGATGGATTGCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-169s1c1
Sequence:CCGGCCGGAAACAGAACTGGTTCTTCTCGAGAAGAACCAGTTCTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007253
CYP4F8 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily F, polypeptide 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007253.3-464s21c1
Sequence:CCGGGATGGGCTCTTGTTAAGTGTTCTCGAGAACACTTAACAAGAGCCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425403    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007253.3-1685s21c1
Sequence:CCGGTTTCAGATTTCCGGTAATAAACTCGAGTTTATTACCGGAAATCTGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-695s1c1
Sequence:CCGGGCCCTTGTAGTGAAACGGAATCTCGAGATTCCGTTTCACTACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-353s1c1
Sequence:CCGGGCCATTACAGACAAGGACATACTCGAGTATGTCCTTGTCTGTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1252s1c1
Sequence:CCGGCAAAGGGAATGTCTGTAACATCTCGAGATGTTACAGACATTCCCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-1276s1c1
Sequence:CCGGCATCTTCGCAATCCATCACAACTCGAGTTGTGATGGATTGCGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007253.2-169s1c1
Sequence:CCGGCCGGAAACAGAACTGGTTCTTCTCGAGAAGAACCAGTTCTGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks