EMAIL THIS PAGE TO A FRIEND

CYP4V2

cytochrome P450, family 4, subfamily V, polypeptide 2

64 Gene Product Result for
Synonyms: BCD CYP4AH1
UniProtKB ID: Q6ZWL3, B7U6W2, Q6ZTM4
Gene ID:
Human(285440) Summary: This gene encodes a member of the cytochrome P450 hemethiolate protein superfamily which are involved in oxidizing various substrates in the metabolic pathway. It is implicated in the metabolism of fatty acid precursors into n-3 polyunsaturated fatty acids. Mutations in this gene result in Bietti crystalline corneoretinal dystrophy. [provided by RefSeq, Jul 2008]
chicken(415121) cytochrome P450, family 4, subfamily V, polypeptide 2
cow(510156) cytochrome P450, family 4, subfamily V, polypeptide 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207352 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046069 predicted 1831
2 SASI_Hs01_00046070 predicted 888
3 SASI_Hs01_00046071 predicted 1809
4 SASI_Hs01_00046072 predicted 1825
5 SASI_Hs01_00046073 predicted 960
6 SASI_Hs01_00046074 predicted 1806
7 SASI_Hs01_00046075 predicted 872
8 SASI_Hs01_00046076 predicted 1137
9 SASI_Hs01_00046077 predicted 974
10 SASI_Hs02_00373910 predicted 1572
11 SASI_Hs01_00046068 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207352
CYP4V2 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily V, polypeptide 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1481s1c1
Sequence:CCGGGACAGTTGATTCTTCGTCCAACTCGAGTTGGACGAAGAATCAACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-198s1c1
Sequence:CCGGGCAGATCATTGAGTACACAGACTCGAGTCTGTGTACTCAATGATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-204s1c1
Sequence:CCGGCATTGAGTACACAGAGGAATACTCGAGTATTCCTCTGTGTACTCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-413s1c1
Sequence:CCGGGAAAGATGTTAACACCCACTTCTCGAGAAGTGGGTGTTAACATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-1515s1c1
Sequence:CCGGGATCAAGTTGAAGAGGAGAAACTCGAGTTTCTCCTCTTCAACTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-790s1c1
Sequence:CCGGGCCAATGAAATGAACGCCAATCTCGAGATTGGCGTTCATTTCATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-368s1c1
Sequence:CCGGGCCTAGGACTTCTTACAAGTACTCGAGTACTTGTAAGAAGTCCTAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1229s1c1
Sequence:CCGGCCGTCATCATTCCCTATGCATCTCGAGATGCATAGGGAATGATGACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1251s1c1
Sequence:CCGGGCACAGAGATCCGAGATACTTCTCGAGAAGTATCTCGGATCTCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-687s1c1
Sequence:CCGGGCTTTGGCTTGATCTCTGGTACTCGAGTACCAGAGATCAAGCCAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207352
CYP4V2 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily V, polypeptide 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1481s1c1
Sequence:CCGGGACAGTTGATTCTTCGTCCAACTCGAGTTGGACGAAGAATCAACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-198s1c1
Sequence:CCGGGCAGATCATTGAGTACACAGACTCGAGTCTGTGTACTCAATGATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-204s1c1
Sequence:CCGGCATTGAGTACACAGAGGAATACTCGAGTATTCCTCTGTGTACTCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-413s1c1
Sequence:CCGGGAAAGATGTTAACACCCACTTCTCGAGAAGTGGGTGTTAACATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-1515s1c1
Sequence:CCGGGATCAAGTTGAAGAGGAGAAACTCGAGTTTCTCCTCTTCAACTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-790s1c1
Sequence:CCGGGCCAATGAAATGAACGCCAATCTCGAGATTGGCGTTCATTTCATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-368s1c1
Sequence:CCGGGCCTAGGACTTCTTACAAGTACTCGAGTACTTGTAAGAAGTCCTAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1229s1c1
Sequence:CCGGCCGTCATCATTCCCTATGCATCTCGAGATGCATAGGGAATGATGACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1251s1c1
Sequence:CCGGGCACAGAGATCCGAGATACTTCTCGAGAAGTATCTCGGATCTCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-687s1c1
Sequence:CCGGGCTTTGGCTTGATCTCTGGTACTCGAGTACCAGAGATCAAGCCAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207352
CYP4V2 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily V, polypeptide 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1481s1c1
Sequence:CCGGGACAGTTGATTCTTCGTCCAACTCGAGTTGGACGAAGAATCAACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-198s1c1
Sequence:CCGGGCAGATCATTGAGTACACAGACTCGAGTCTGTGTACTCAATGATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-204s1c1
Sequence:CCGGCATTGAGTACACAGAGGAATACTCGAGTATTCCTCTGTGTACTCAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-413s1c1
Sequence:CCGGGAAAGATGTTAACACCCACTTCTCGAGAAGTGGGTGTTAACATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151148    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-1515s1c1
Sequence:CCGGGATCAAGTTGAAGAGGAGAAACTCGAGTTTCTCCTCTTCAACTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-790s1c1
Sequence:CCGGGCCAATGAAATGAACGCCAATCTCGAGATTGGCGTTCATTTCATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-368s1c1
Sequence:CCGGGCCTAGGACTTCTTACAAGTACTCGAGTACTTGTAAGAAGTCCTAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1229s1c1
Sequence:CCGGCCGTCATCATTCCCTATGCATCTCGAGATGCATAGGGAATGATGACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207352.1-1251s1c1
Sequence:CCGGGCACAGAGATCCGAGATACTTCTCGAGAAGTATCTCGGATCTCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207352.1-687s1c1
Sequence:CCGGGCTTTGGCTTGATCTCTGGTACTCGAGTACCAGAGATCAAGCCAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)