EMAIL THIS PAGE TO A FRIEND

CYP4X1

cytochrome P450, family 4, subfamily X, polypeptide 1

95 Gene Product Result for
Synonyms: CYPIVX1
UniProtKB ID: Q8N118, G3V1U1, Q5VVE5, Q6ZN67, Q8NAZ3
Gene ID:
Human(260293) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The expression pattern of a similar rat protein suggests that this protein may be involved in neurovascular function in the brain. [provided by RefSeq, Jul 2008]
Mouse(81906) cytochrome P450, family 4, subfamily x, polypeptide 1
Rat(246767) cytochrome P450, family 4, subfamily x, polypeptide 1
dog(482505) cytochrome P450, family 4, subfamily X, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003947 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003947 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003947 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178033 Rosetta Predictions human pricing
NM_145675 Rosetta Predictions rat pricing
NM_001003947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092007 predicted 589
2 SASI_Hs01_00092008 predicted 1847
3 SASI_Hs01_00092009 predicted 1809
4 SASI_Hs02_00369514 predicted 1146
5 SASI_Hs01_00092011 predicted 1833
6 SASI_Hs02_00369515 predicted 740
7 SASI_Hs01_00092012 predicted 1157
8 SASI_Hs01_00092014 predicted 1544
9 SASI_Hs01_00092015 predicted 1243
10 SASI_Hs01_00092016 predicted 1849
11 SASI_Hs01_00092010 predicted 1626
12 SASI_Hs01_00092013 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145675 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067832 predicted 686
2 SASI_Rn01_00067833 predicted 1238
3 SASI_Rn02_00268725 predicted 1253
4 SASI_Rn01_00067834 predicted 1071
5 SASI_Rn01_00067835 predicted 520
6 SASI_Rn01_00067836 predicted 742
7 SASI_Rn01_00067838 predicted 655
8 SASI_Rn01_00067839 predicted 1037
9 SASI_Rn02_00268726 predicted 1270
10 SASI_Rn02_00268727 predicted 567
11 SASI_Rn01_00067831 predicted 1197
12 SASI_Rn01_00067837 predicted 996
13 SASI_Rn01_00067840 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105622 predicted 688
2 SASI_Mm01_00105623 predicted 1196
3 SASI_Mm01_00105624 predicted 513
4 SASI_Mm01_00105625 predicted 734
5 SASI_Mm01_00105626 predicted 1283
6 SASI_Mm01_00105627 predicted 1072
7 SASI_Mm01_00105628 predicted 658
8 SASI_Mm02_00286396 predicted 743
9 SASI_Mm01_00105630 predicted 563
10 SASI_Mm01_00105631 predicted 410
11 SASI_Mm01_00105629 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178033
CYP4X1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily X, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178033.1-1791s21c1
Sequence:CCGGACAATGATTAAACGTACTTTGCTCGAGCAAAGTACGTTTAATCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178033.1-941s21c1
Sequence:CCGGTTGTATCACAGTGACATAATTCTCGAGAATTATGTCACTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1628s1c1
Sequence:CCGGGCCATGATTGAGTTAAAGGTACTCGAGTACCTTTAACTCAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-419s1c1
Sequence:CCGGCACCAGAAGTTTATTCAGGATCTCGAGATCCTGAATAAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-739s1c1
Sequence:CCGGGCTGGATAAGTGGGAGAAGATCTCGAGATCTTCTCCCACTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-870s1c1
Sequence:CCGGGCACCCATGATCCTTATGCAACTCGAGTTGCATAAGGATCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1732s1c1
Sequence:CCGGGCCCAAGAATGGGATGTATTTCTCGAGAAATACATCCCATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178033
CYP4X1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily X, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178033.1-1791s21c1
Sequence:CCGGACAATGATTAAACGTACTTTGCTCGAGCAAAGTACGTTTAATCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178033.1-941s21c1
Sequence:CCGGTTGTATCACAGTGACATAATTCTCGAGAATTATGTCACTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1628s1c1
Sequence:CCGGGCCATGATTGAGTTAAAGGTACTCGAGTACCTTTAACTCAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-419s1c1
Sequence:CCGGCACCAGAAGTTTATTCAGGATCTCGAGATCCTGAATAAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-739s1c1
Sequence:CCGGGCTGGATAAGTGGGAGAAGATCTCGAGATCTTCTCCCACTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-870s1c1
Sequence:CCGGGCACCCATGATCCTTATGCAACTCGAGTTGCATAAGGATCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1732s1c1
Sequence:CCGGGCCCAAGAATGGGATGTATTTCTCGAGAAATACATCCCATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178033
CYP4X1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily X, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418219    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178033.1-1791s21c1
Sequence:CCGGACAATGATTAAACGTACTTTGCTCGAGCAAAGTACGTTTAATCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178033.1-941s21c1
Sequence:CCGGTTGTATCACAGTGACATAATTCTCGAGAATTATGTCACTGTGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1628s1c1
Sequence:CCGGGCCATGATTGAGTTAAAGGTACTCGAGTACCTTTAACTCAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-419s1c1
Sequence:CCGGCACCAGAAGTTTATTCAGGATCTCGAGATCCTGAATAAACTTCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-739s1c1
Sequence:CCGGGCTGGATAAGTGGGAGAAGATCTCGAGATCTTCTCCCACTTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-870s1c1
Sequence:CCGGGCACCCATGATCCTTATGCAACTCGAGTTGCATAAGGATCATGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178033.1-1732s1c1
Sequence:CCGGGCCCAAGAATGGGATGTATTTCTCGAGAAATACATCCCATTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003947
CYP4X1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily X, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-296s1c1
Sequence:CCGGCGAAGATATTTCTGAGCAGAACTCGAGTTCTGCTCAGAAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-741s1c1
Sequence:CCGGCCAGGAGTTAGGCAAAGTGATCTCGAGATCACTTTGCCTAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-282s1c1
Sequence:CCGGTGACCCAGACTATGCGAAGATCTCGAGATCTTCGCATAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-1198s1c1
Sequence:CCGGGCAGGTATGACTGTGGTTCTTCTCGAGAAGAACCACAGTCATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-643s1c1
Sequence:CCGGGCAACATTTGAACTTGGTGAACTCGAGTTCACCAAGTTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003947
CYP4X1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily X, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-296s1c1
Sequence:CCGGCGAAGATATTTCTGAGCAGAACTCGAGTTCTGCTCAGAAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-741s1c1
Sequence:CCGGCCAGGAGTTAGGCAAAGTGATCTCGAGATCACTTTGCCTAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-282s1c1
Sequence:CCGGTGACCCAGACTATGCGAAGATCTCGAGATCTTCGCATAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-1198s1c1
Sequence:CCGGGCAGGTATGACTGTGGTTCTTCTCGAGAAGAACCACAGTCATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-643s1c1
Sequence:CCGGGCAACATTTGAACTTGGTGAACTCGAGTTCACCAAGTTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003947
CYP4X1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily X, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-296s1c1
Sequence:CCGGCGAAGATATTTCTGAGCAGAACTCGAGTTCTGCTCAGAAATATCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-741s1c1
Sequence:CCGGCCAGGAGTTAGGCAAAGTGATCTCGAGATCACTTTGCCTAACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-282s1c1
Sequence:CCGGTGACCCAGACTATGCGAAGATCTCGAGATCTTCGCATAGTCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-1198s1c1
Sequence:CCGGGCAGGTATGACTGTGGTTCTTCTCGAGAAGAACCACAGTCATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003947.1-643s1c1
Sequence:CCGGGCAACATTTGAACTTGGTGAACTCGAGTTCACCAAGTTCAAATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks