EMAIL THIS PAGE TO A FRIEND

CYP4Z1

cytochrome P450, family 4, subfamily Z, polypeptide 1

19 Gene Product Result for
Synonyms: CYP4A20
Species: Human CYP4Z1(199974)
UniProtKB ID: Q86W10, Q5VVE4
Gene ID:
Human(199974) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This gene is part of a cluster of cytochrome P450 genes on chromosome 1p33. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178134 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178134 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178134 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108691 MISSION® esiRNA esiRNA human CYP4Z1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178134 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178134 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092417 predicted 1530
2 SASI_Hs01_00092419 predicted 265
3 SASI_Hs01_00092420 predicted 1620
4 SASI_Hs01_00092421 predicted 1412
5 SASI_Hs01_00092422 predicted 1482
6 SASI_Hs01_00092423 predicted 1384
7 SASI_Hs01_00092424 predicted 1086
8 SASI_Hs01_00092425 predicted 186
9 SASI_Hs01_00092418 predicted 1611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178134
CYP4Z1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 4, subfamily Z, polypeptide 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-414s1c1
Sequence:CCGGCCAGATTGTGAAACCTGGCTTCTCGAGAAGCCAGGTTTCACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-981s1c1
Sequence:CCGGCCTTTACTGCTTGGCAAAGTACTCGAGTACTTTGCCAAGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-190s1c1
Sequence:CCGGGTAAAGGAGTTTGAGGTGTATCTCGAGATACACCTCAAACTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-1280s1c1
Sequence:CCGGCCTTGAGATTCTCCAGGGAAACTCGAGTTTCCCTGGAGAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178134.2-1530s21c1
Sequence:CCGGCCTTTCGTATAAGAATTAATGCTCGAGCATTAATTCTTATACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178134.2-1313s21c1
Sequence:CCGGTACATCCCTATGCCTTCATACCTCGAGGTATGAAGGCATAGGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178134
CYP4Z1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 4, subfamily Z, polypeptide 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-414s1c1
Sequence:CCGGCCAGATTGTGAAACCTGGCTTCTCGAGAAGCCAGGTTTCACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-981s1c1
Sequence:CCGGCCTTTACTGCTTGGCAAAGTACTCGAGTACTTTGCCAAGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-190s1c1
Sequence:CCGGGTAAAGGAGTTTGAGGTGTATCTCGAGATACACCTCAAACTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-1280s1c1
Sequence:CCGGCCTTGAGATTCTCCAGGGAAACTCGAGTTTCCCTGGAGAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178134.2-1530s21c1
Sequence:CCGGCCTTTCGTATAAGAATTAATGCTCGAGCATTAATTCTTATACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178134.2-1313s21c1
Sequence:CCGGTACATCCCTATGCCTTCATACCTCGAGGTATGAAGGCATAGGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178134
CYP4Z1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 4, subfamily Z, polypeptide 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-414s1c1
Sequence:CCGGCCAGATTGTGAAACCTGGCTTCTCGAGAAGCCAGGTTTCACAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-981s1c1
Sequence:CCGGCCTTTACTGCTTGGCAAAGTACTCGAGTACTTTGCCAAGCAGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-190s1c1
Sequence:CCGGGTAAAGGAGTTTGAGGTGTATCTCGAGATACACCTCAAACTCCTTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178134.2-1280s1c1
Sequence:CCGGCCTTGAGATTCTCCAGGGAAACTCGAGTTTCCCTGGAGAATCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178134.2-1530s21c1
Sequence:CCGGCCTTTCGTATAAGAATTAATGCTCGAGCATTAATTCTTATACGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178134.2-1313s21c1
Sequence:CCGGTACATCCCTATGCCTTCATACCTCGAGGTATGAAGGCATAGGGATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks