EMAIL THIS PAGE TO A FRIEND

CYP51A1

cytochrome P450, family 51, subfamily A, polypeptide 1

34 Gene Product Result for
Synonyms: CP51 CYP51 CYPL1 LDM P450-14DM P450L1
Gene ID:
Human(1595) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
chicken(420548) cytochrome P450, family 51, subfamily A, polypeptide 1
cow(505060) cytochrome P450, family 51, subfamily A, polypeptide 1
dog(475225) cytochrome P450, family 51, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000786 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000786 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191596 predicted 1395
2 SASI_Hs01_00191597 predicted 1422
3 SASI_Hs01_00191599 predicted 1732
4 SASI_Hs01_00191600 predicted 482
5 SASI_Hs01_00191601 predicted 444
6 SASI_Hs01_00191602 predicted 677
7 SASI_Hs01_00191603 predicted 1544
8 SASI_Hs01_00191604 predicted 1697
9 SASI_Hs01_00191605 predicted 416
10 SASI_Hs02_00303228 predicted 1734
11 SASI_Hs01_00191598 predicted 830
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000786
VALIDATED
CYP51A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 51, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1837s1c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1601s1c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000786.2-776s1c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1788s1c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-834s1c1
Sequence:CCGGGCCTTAACATAGCCCACTTTACTCGAGTAAAGTGGGCTATGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1668s21c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-607s21c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1619s21c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1432s21c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000786
VALIDATED
CYP51A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 51, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1837s1c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1601s1c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000786.2-776s1c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1788s1c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-834s1c1
Sequence:CCGGGCCTTAACATAGCCCACTTTACTCGAGTAAAGTGGGCTATGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1668s21c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-607s21c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1619s21c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1432s21c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000786
VALIDATED
CYP51A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 51, subfamily A, polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1837s1c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064375    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1601s1c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000786.2-776s1c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-1788s1c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_000786.2-834s1c1
Sequence:CCGGGCCTTAACATAGCCCACTTTACTCGAGTAAAGTGGGCTATGTTAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1668s21c1
Sequence:CCGGCCGTTACAAACGAAGATCAAACTCGAGTTTGATCTTCGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-607s21c1
Sequence:CCGGGTTGCATACGATGTGCCTAATCTCGAGATTAGGCACATCGTATGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1619s21c1
Sequence:CCGGCCACTGTGAATTATACAACTACTCGAGTAGTTGTATAATTCACAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000786.3-1432s21c1
Sequence:CCGGCGCCTGGACTTTAATCCTGATCTCGAGATCAGGATTAAAGTCCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks