EMAIL THIS PAGE TO A FRIEND

CYP7A1

cytochrome P450, family 7, subfamily A, polypeptide 1

81 Gene Product Result for
Synonyms: CP7A CYP7 CYPVII
UniProtKB ID: P22680, P78454, Q3MIL8, Q7KZ19
Gene ID:
Human(1581) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
Mouse(13122) cytochrome P450, family 7, subfamily a, polypeptide 1
Rat(25428) cytochrome P450, family 7, subfamily a, polypeptide 1
chicken(414834) cytochrome P450, family 7, subfamily A, polypeptide 1
cow(510507) cytochrome P450, family 7, subfamily A, polypeptide 1
dog(486962) cytochrome P450, family 7, subfamily A, polypeptide 1
domestic guinea pig(100337633) cholesterol 7-alpha-hydroxylase
Domestic Rabbit(100328551) cytochrome P450, family 7, subfamily A, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
K1003 Ketoconazole ≥98% (HPLC) human, mouse, rat pricing
UC280 Ketoconazole human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000780 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000780 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000780 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007824 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007824 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007824 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000780 Rosetta Predictions human pricing
NM_012942 Rosetta Predictions rat pricing
NM_007824 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000780 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102767 predicted 463
2 SASI_Hs01_00102768 predicted 1190
3 SASI_Hs01_00102769 predicted 1586
4 SASI_Hs01_00102770 predicted 1335
5 SASI_Hs02_00303213 predicted 1221
6 SASI_Hs02_00303214 predicted 1106
7 SASI_Hs01_00102771 predicted 1660
8 SASI_Hs01_00102772 predicted 1237
9 SASI_Hs01_00102773 predicted 1229
10 SASI_Hs02_00303215 predicted 1143
11 SASI_Hs01_00102774 predicted 1085
12 SASI_Hs01_00102775 predicted 1231
13 SASI_Hs01_00102776 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116494 predicted 566
2 SASI_Rn01_00116497 predicted 1518
3 SASI_Rn01_00116498 predicted 1028
4 SASI_Rn01_00116499 predicted 372
5 SASI_Rn02_00260507 predicted 273
6 SASI_Rn01_00116500 predicted 1627
7 SASI_Rn01_00116501 predicted 1504
8 SASI_Rn01_00116503 predicted 547
9 SASI_Rn02_00260508 predicted 895
10 SASI_Rn02_00260509 predicted 1039
11 SASI_Rn01_00116495 predicted 591
12 SASI_Rn01_00116496 predicted 1545
13 SASI_Rn01_00116502 predicted 1199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007824 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188809 predicted 1660
2 SASI_Mm01_00188810 predicted 200
3 SASI_Mm01_00188811 predicted 305
4 SASI_Mm01_00188814 predicted 1561
5 SASI_Mm02_00312552 predicted 1530
6 SASI_Mm01_00188816 predicted 394
7 SASI_Mm02_00312553 predicted 988
8 SASI_Mm01_00188817 predicted 588
9 SASI_Mm01_00188818 predicted 1310
10 SASI_Mm02_00312554 predicted 997
11 SASI_Mm01_00188812 predicted 1536
12 SASI_Mm01_00188813 predicted 623
13 SASI_Mm01_00188815 predicted 487
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000780
CYP7A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 7, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-830s21c1
Sequence:CCGGTGATCAGCCTGCGCATGTTTCCTCGAGGAAACATGCGCAGGCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-1335s21c1
Sequence:CCGGTTGTAATGGACTCAAGTTAAACTCGAGTTTAACTTGAGTCCATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-608s1c1
Sequence:CCGGGCTGGGTATTTAACTATCTTTCTCGAGAAAGATAGTTAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1480s1c1
Sequence:CCGGCCAAGCTAAATGTCCACCTTTCTCGAGAAAGGTGGACATTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1235s1c1
Sequence:CCGGCCACAGTTAATGCACTTAGATCTCGAGATCTAAGTGCATTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1192s1c1
Sequence:CCGGCGGTTCCTACAACATCCGAAACTCGAGTTTCGGATGTTGTAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-158s1c1
Sequence:CCGGCCACCTCTAGAGAATGGATTACTCGAGTAATCCATTCTCTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000780
CYP7A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 7, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-830s21c1
Sequence:CCGGTGATCAGCCTGCGCATGTTTCCTCGAGGAAACATGCGCAGGCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-1335s21c1
Sequence:CCGGTTGTAATGGACTCAAGTTAAACTCGAGTTTAACTTGAGTCCATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-608s1c1
Sequence:CCGGGCTGGGTATTTAACTATCTTTCTCGAGAAAGATAGTTAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1480s1c1
Sequence:CCGGCCAAGCTAAATGTCCACCTTTCTCGAGAAAGGTGGACATTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1235s1c1
Sequence:CCGGCCACAGTTAATGCACTTAGATCTCGAGATCTAAGTGCATTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1192s1c1
Sequence:CCGGCGGTTCCTACAACATCCGAAACTCGAGTTTCGGATGTTGTAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-158s1c1
Sequence:CCGGCCACCTCTAGAGAATGGATTACTCGAGTAATCCATTCTCTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000780
CYP7A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 7, subfamily A, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-830s21c1
Sequence:CCGGTGATCAGCCTGCGCATGTTTCCTCGAGGAAACATGCGCAGGCTGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000780.3-1335s21c1
Sequence:CCGGTTGTAATGGACTCAAGTTAAACTCGAGTTTAACTTGAGTCCATTACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-608s1c1
Sequence:CCGGGCTGGGTATTTAACTATCTTTCTCGAGAAAGATAGTTAAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1480s1c1
Sequence:CCGGCCAAGCTAAATGTCCACCTTTCTCGAGAAAGGTGGACATTTAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1235s1c1
Sequence:CCGGCCACAGTTAATGCACTTAGATCTCGAGATCTAAGTGCATTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-1192s1c1
Sequence:CCGGCGGTTCCTACAACATCCGAAACTCGAGTTTCGGATGTTGTAGGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000780.2-158s1c1
Sequence:CCGGCCACCTCTAGAGAATGGATTACTCGAGTAATCCATTCTCTAGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007824
CYP7A1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 7, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1128s1c1
Sequence:CCGGCTCCAGTGCATCCTTGAATATCTCGAGATATTCAAGGATGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1339s1c1
Sequence:CCGGGGAAACAAGCTGAAGTATTTCCTCGAGGAAATACTTCAGCTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1222s1c1
Sequence:CCGGGCTCTTTACCCACAGTTAATGCTCGAGCATTAACTGTGGGTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007824.2-3584s1c1
Sequence:CCGGCCAAAGTTACTCTTCCCGTTTCTCGAGAAACGGGAAGAGTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-736s1c1
Sequence:CCGGCACTTGTTCAAGACCGCACATCTCGAGATGTGCGGTCTTGAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-937s1c1
Sequence:CCGGGCAACCTTCTGGAGCTTATTTCTCGAGAAATAAGCTCCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007824.2-1803s1c1
Sequence:CCGGGCAGGGTTCTTTCCTAAGGAACTCGAGTTCCTTAGGAAAGAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-307s1c2
Sequence:CCGGCTGTCATACCACAAAGTCTTACTCGAGTAAGACTTTGTGGTATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007824
CYP7A1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 7, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1128s1c1
Sequence:CCGGCTCCAGTGCATCCTTGAATATCTCGAGATATTCAAGGATGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1339s1c1
Sequence:CCGGGGAAACAAGCTGAAGTATTTCCTCGAGGAAATACTTCAGCTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1222s1c1
Sequence:CCGGGCTCTTTACCCACAGTTAATGCTCGAGCATTAACTGTGGGTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007824.2-3584s1c1
Sequence:CCGGCCAAAGTTACTCTTCCCGTTTCTCGAGAAACGGGAAGAGTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-736s1c1
Sequence:CCGGCACTTGTTCAAGACCGCACATCTCGAGATGTGCGGTCTTGAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-937s1c1
Sequence:CCGGGCAACCTTCTGGAGCTTATTTCTCGAGAAATAAGCTCCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007824.2-1803s1c1
Sequence:CCGGGCAGGGTTCTTTCCTAAGGAACTCGAGTTCCTTAGGAAAGAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-307s1c2
Sequence:CCGGCTGTCATACCACAAAGTCTTACTCGAGTAAGACTTTGTGGTATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007824
CYP7A1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 7, subfamily A, polypeptide 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217532    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1128s1c1
Sequence:CCGGCTCCAGTGCATCCTTGAATATCTCGAGATATTCAAGGATGCACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215563    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1339s1c1
Sequence:CCGGGGAAACAAGCTGAAGTATTTCCTCGAGGAAATACTTCAGCTTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007824.2-1222s1c1
Sequence:CCGGGCTCTTTACCCACAGTTAATGCTCGAGCATTAACTGTGGGTAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176424    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007824.2-3584s1c1
Sequence:CCGGCCAAAGTTACTCTTCCCGTTTCTCGAGAAACGGGAAGAGTAACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-736s1c1
Sequence:CCGGCACTTGTTCAAGACCGCACATCTCGAGATGTGCGGTCTTGAACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-937s1c1
Sequence:CCGGGCAACCTTCTGGAGCTTATTTCTCGAGAAATAAGCTCCAGAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194616    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_007824.2-1803s1c1
Sequence:CCGGGCAGGGTTCTTTCCTAAGGAACTCGAGTTCCTTAGGAAAGAACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007824.2-307s1c2
Sequence:CCGGCTGTCATACCACAAAGTCTTACTCGAGTAAGACTTTGTGGTATGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks