EMAIL THIS PAGE TO A FRIEND

CYP7B1

cytochrome P450, family 7, subfamily B, polypeptide 1

Synonyms: CBAS3 CP7B SPG5A
UniProtKB ID: O75881, B2RN07, Q9UNF5
Gene ID:
Human(9420) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. [provided by RefSeq, Jul 2008]
Mouse(13123) cytochrome P450, family 7, subfamily b, polypeptide 1
Rat(25429) cytochrome P450, family 7, subfamily b, polypeptide 1
chicken(420164) cytochrome P450, family 7, subfamily B, polypeptide 1
dog(486973) cytochrome P450, family 7, subfamily B, polypeptide 1
cow(529552) cytochrome P450, family 7, subfamily B, polypeptide 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007825 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007825 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007825 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004820 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033831 MISSION® esiRNA esiRNA human CYP7B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004820 Rosetta Predictions human pricing
NM_019138 Rosetta Predictions rat pricing
NM_007825 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338382 predicted 971
2 SASI_Hs02_00338383 predicted 1659
3 SASI_Hs01_00136546 predicted 1430
4 SASI_Hs01_00136547 predicted 1043
5 SASI_Hs01_00136548 predicted 1318
6 SASI_Hs01_00136552 predicted 1079
7 SASI_Hs01_00136553 predicted 1271
8 SASI_Hs02_00338384 predicted 1273
9 SASI_Hs01_00136555 predicted 1097
10 SASI_Hs02_00338385 predicted 1092
11 SASI_Hs01_00136549 predicted 912
12 SASI_Hs01_00136550 predicted 1768
13 SASI_Hs01_00136551 predicted 825
14 SASI_Hs01_00136554 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261890 predicted 1006
2 SASI_Rn02_00261891 predicted 1351
3 SASI_Rn02_00261892 predicted 1455
4 SASI_Rn02_00261893 predicted 546
5 SASI_Rn02_00261894 predicted 1534
6 SASI_Rn02_00261895 predicted 477
7 SASI_Rn02_00261896 predicted 781
8 SASI_Rn02_00261897 predicted 1480
9 SASI_Rn02_00261898 predicted 488
10 SASI_Rn02_00261899 predicted 1047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007825 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134090 predicted 818
2 SASI_Mm01_00134091 predicted 1346
3 SASI_Mm01_00134092 predicted 1508
4 SASI_Mm01_00134093 predicted 668
5 SASI_Mm01_00134094 predicted 1459
6 SASI_Mm01_00134095 predicted 1017
7 SASI_Mm01_00134096 predicted 1246
8 SASI_Mm01_00134097 predicted 796
9 SASI_Mm01_00134098 predicted 1261
10 SASI_Mm01_00134099 predicted 1180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007825
VALIDATED
CYP7B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 7, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007825.1-1621s1c1
Sequence:CCGGCTTTGCAGAGTAAGGCTGCATCTCGAGATGCAGCCTTACTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007825.1-743s1c1
Sequence:CCGGCCCATACTTAGTATCTGACATCTCGAGATGTCAGATACTAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1302s1c1
Sequence:CCGGCCAAAGGAATTTAGGTTCGATCTCGAGATCGAACCTAAATTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-202s1c1
Sequence:CCGGCTCGTGAACCACCCTTGATAACTCGAGTTATCAAGGGTGGTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1271s1c1
Sequence:CCGGCATACACAATGACCCGGAAATCTCGAGATTTCCGGGTCATTGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007825
VALIDATED
CYP7B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 7, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007825.1-1621s1c1
Sequence:CCGGCTTTGCAGAGTAAGGCTGCATCTCGAGATGCAGCCTTACTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007825.1-743s1c1
Sequence:CCGGCCCATACTTAGTATCTGACATCTCGAGATGTCAGATACTAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1302s1c1
Sequence:CCGGCCAAAGGAATTTAGGTTCGATCTCGAGATCGAACCTAAATTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-202s1c1
Sequence:CCGGCTCGTGAACCACCCTTGATAACTCGAGTTATCAAGGGTGGTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1271s1c1
Sequence:CCGGCATACACAATGACCCGGAAATCTCGAGATTTCCGGGTCATTGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007825
VALIDATED
CYP7B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 7, subfamily B, polypeptide 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200240    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007825.1-1621s1c1
Sequence:CCGGCTTTGCAGAGTAAGGCTGCATCTCGAGATGCAGCCTTACTCTGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007825.1-743s1c1
Sequence:CCGGCCCATACTTAGTATCTGACATCTCGAGATGTCAGATACTAAGTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1302s1c1
Sequence:CCGGCCAAAGGAATTTAGGTTCGATCTCGAGATCGAACCTAAATTCCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-202s1c1
Sequence:CCGGCTCGTGAACCACCCTTGATAACTCGAGTTATCAAGGGTGGTTCACGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007825.1-1271s1c1
Sequence:CCGGCATACACAATGACCCGGAAATCTCGAGATTTCCGGGTCATTGTGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004820
CYP7B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 7, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-895s1c1
Sequence:CCGGCCCATTGAGCTTCTAGGAAATCTCGAGATTTCCTAGAAGCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1221s1c1
Sequence:CCGGCCACCTCACCAGAGAACAATTCTCGAGAATTGTTCTCTGGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1158s1c1
Sequence:CCGGGCGTGACGAAATTGACCGTTTCTCGAGAAACGGTCAATTTCGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-639s1c1
Sequence:CCGGGCAAGGCAAATCTTTGGACATCTCGAGATGTCCAAAGATTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-459s1c1
Sequence:CCGGTGGTGGAAAGTACATAACATTCTCGAGAATGTTATGTACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004820.3-526s21c1
Sequence:CCGGCAATTAAGCTTTCGAGTATTTCTCGAGAAATACTCGAAAGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004820.3-1771s21c1
Sequence:CCGGCATCCTAAGCTCATCTATTTCCTCGAGGAAATAGATGAGCTTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004820
CYP7B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 7, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-895s1c1
Sequence:CCGGCCCATTGAGCTTCTAGGAAATCTCGAGATTTCCTAGAAGCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1221s1c1
Sequence:CCGGCCACCTCACCAGAGAACAATTCTCGAGAATTGTTCTCTGGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1158s1c1
Sequence:CCGGGCGTGACGAAATTGACCGTTTCTCGAGAAACGGTCAATTTCGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-639s1c1
Sequence:CCGGGCAAGGCAAATCTTTGGACATCTCGAGATGTCCAAAGATTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-459s1c1
Sequence:CCGGTGGTGGAAAGTACATAACATTCTCGAGAATGTTATGTACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004820.3-526s21c1
Sequence:CCGGCAATTAAGCTTTCGAGTATTTCTCGAGAAATACTCGAAAGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004820.3-1771s21c1
Sequence:CCGGCATCCTAAGCTCATCTATTTCCTCGAGGAAATAGATGAGCTTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004820
CYP7B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 7, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-895s1c1
Sequence:CCGGCCCATTGAGCTTCTAGGAAATCTCGAGATTTCCTAGAAGCTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1221s1c1
Sequence:CCGGCCACCTCACCAGAGAACAATTCTCGAGAATTGTTCTCTGGTGAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-1158s1c1
Sequence:CCGGGCGTGACGAAATTGACCGTTTCTCGAGAAACGGTCAATTTCGTCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-639s1c1
Sequence:CCGGGCAAGGCAAATCTTTGGACATCTCGAGATGTCCAAAGATTTGCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004820.2-459s1c1
Sequence:CCGGTGGTGGAAAGTACATAACATTCTCGAGAATGTTATGTACTTTCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004820.3-526s21c1
Sequence:CCGGCAATTAAGCTTTCGAGTATTTCTCGAGAAATACTCGAAAGCTTAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004820.3-1771s21c1
Sequence:CCGGCATCCTAAGCTCATCTATTTCCTCGAGGAAATAGATGAGCTTAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks