EMAIL THIS PAGE TO A FRIEND

CYP8B1

cytochrome P450, family 8, subfamily B, polypeptide 1

49 Gene Product Result for
Synonyms: CP8B CYP12
UniProtKB ID: Q9UNU6, B2RCY3, O75958, Q6NWT2, Q6NWT3
Gene ID:
Human(1582) Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the conversion of 7 alpha-hydroxy-4-cholesten-3-one into 7-alpha,12-alpha-dihydroxy-4-cholesten-3-one. The balance between these two steroids determines the relative amounts of cholic acid and chenodeoxycholic acid both of which are secreted in the bile and affect the solubility of cholesterol. This gene is unique among the cytochrome P450 genes in that it is intronless. [provided by RefSeq, Jul 2008]
Mouse(13124) cytochrome P450, family 8, subfamily b, polypeptide 1
Rat(81924) cytochrome P450, family 8, subfamily b, polypeptide 1
Zebrafish(445281) cytochrome P450, family 8, subfamily B, polypeptide 1
cow(538964) cytochrome P450, family 8, subfamily B, polypeptide 1
chicken(425055) cytochrome P450, family 8, subfamily B, polypeptide 1
Domestic Rabbit(100009301) cytochrome P450, family 8, subfamily B, polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004391 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004391 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004391 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU040681 MISSION® esiRNA esiRNA human CYP8B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004391 Rosetta Predictions human pricing
NM_031241 Rosetta Predictions rat pricing
NM_010012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004391 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144899 predicted 920
2 SASI_Hs01_00144900 predicted 1129
3 SASI_Hs01_00144902 predicted 1583
4 SASI_Hs01_00144903 predicted 1523
5 SASI_Hs01_00144904 predicted 615
6 SASI_Hs01_00144905 predicted 721
7 SASI_Hs01_00144906 predicted 650
8 SASI_Hs01_00144907 predicted 868
9 SASI_Hs01_00144908 predicted 1451
10 SASI_Hs02_00337501 predicted 1189
11 SASI_Hs01_00144901 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031241 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050654 predicted 627
2 SASI_Rn01_00050655 predicted 758
3 SASI_Rn01_00050656 predicted 1618
4 SASI_Rn01_00050658 predicted 931
5 SASI_Rn01_00050659 predicted 995
6 SASI_Rn01_00050660 predicted 1386
7 SASI_Rn01_00050661 predicted 1736
8 SASI_Rn01_00050662 predicted 1224
9 SASI_Rn02_00264527 predicted 412
10 SASI_Rn02_00264528 predicted 1331
11 SASI_Rn01_00050657 predicted 1387
12 SASI_Rn01_00050663 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317617 predicted 687
2 SASI_Mm01_00070623 predicted 851
3 SASI_Mm01_00070624 predicted 1011
4 SASI_Mm01_00070625 predicted 1584
5 SASI_Mm01_00070626 predicted 318
6 SASI_Mm01_00070627 predicted 412
7 SASI_Mm01_00070628 predicted 539
8 SASI_Mm01_00070630 predicted 1308
9 SASI_Mm01_00070631 predicted 365
10 SASI_Mm01_00070632 predicted 958
11 SASI_Mm01_00070629 predicted 537
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004391
CYP8B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 8, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004391.2-830s21c1
Sequence:CCGGCTCTTTCGCTTCTGCTATTACCTCGAGGTAATAGCAGAAGCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004391.2-1994s21c1
Sequence:CCGGCATCTGACAGGCTTATCATTCCTCGAGGAATGATAAGCCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-592s1c1
Sequence:CCGGCCTCAAGGACACACAGAGAAACTCGAGTTTCTCTGTGTGTCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1675s1c1
Sequence:CCGGGAAGCTCTTTATCCTGCTTATCTCGAGATAAGCAGGATAAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-725s1c1
Sequence:CCGGGATGGCTTGAAGGATCTTAATCTCGAGATTAAGATCCTTCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1138s1c1
Sequence:CCGGGCAGGACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-472s1c1
Sequence:CCGGCCGGAAGAATATGTTTGAATTCTCGAGAATTCAAACATATTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004391
CYP8B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 8, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004391.2-830s21c1
Sequence:CCGGCTCTTTCGCTTCTGCTATTACCTCGAGGTAATAGCAGAAGCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004391.2-1994s21c1
Sequence:CCGGCATCTGACAGGCTTATCATTCCTCGAGGAATGATAAGCCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-592s1c1
Sequence:CCGGCCTCAAGGACACACAGAGAAACTCGAGTTTCTCTGTGTGTCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1675s1c1
Sequence:CCGGGAAGCTCTTTATCCTGCTTATCTCGAGATAAGCAGGATAAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-725s1c1
Sequence:CCGGGATGGCTTGAAGGATCTTAATCTCGAGATTAAGATCCTTCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1138s1c1
Sequence:CCGGGCAGGACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-472s1c1
Sequence:CCGGCCGGAAGAATATGTTTGAATTCTCGAGAATTCAAACATATTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004391
CYP8B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 8, subfamily B, polypeptide 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004391.2-830s21c1
Sequence:CCGGCTCTTTCGCTTCTGCTATTACCTCGAGGTAATAGCAGAAGCGAAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419815    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004391.2-1994s21c1
Sequence:CCGGCATCTGACAGGCTTATCATTCCTCGAGGAATGATAAGCCTGTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-592s1c1
Sequence:CCGGCCTCAAGGACACACAGAGAAACTCGAGTTTCTCTGTGTGTCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1675s1c1
Sequence:CCGGGAAGCTCTTTATCCTGCTTATCTCGAGATAAGCAGGATAAAGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-725s1c1
Sequence:CCGGGATGGCTTGAAGGATCTTAATCTCGAGATTAAGATCCTTCAAGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-1138s1c1
Sequence:CCGGGCAGGACAAGTTCAACTTCATCTCGAGATGAAGTTGAACTTGTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004391.1-472s1c1
Sequence:CCGGCCGGAAGAATATGTTTGAATTCTCGAGAATTCAAACATATTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010012
CYP8B1 MISSION shRNA Bacterial Glycerol Stock
cytochrome P450, family 8, subfamily B, polypeptide 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-853s21c1
Sequence:CCGGTCATCCATGCAGGACAAATTTCTCGAGAAATTTGTCCTGCATGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-655s21c1
Sequence:CCGGTTCAGGAAGTTCCGTCGATTTCTCGAGAAATCGACGGAACTTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010012.2-1717s21c1
Sequence:CCGGCATGTGGTCAGCTCAGTTTACCTCGAGGTAAACTGAGCTGACCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-493s21c1
Sequence:CCGGTTGGTGATGCTAGGGCCTAAACTCGAGTTTAGGCCCTAGCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-1121s21c1
Sequence:CCGGGGGTGGTACAGGAGGATTATGCTCGAGCATAATCCTCCTGTACCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-1419s1c1
Sequence:CCGGGATTATGTACTTCGACTTCAACTCGAGTTGAAGTCGAAGTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-666s1c1
Sequence:CCGGCCGTCGATTTGACTTTCTCTTCTCGAGAAGAGAAAGTCAAATCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010012
CYP8B1 MISSION shRNA shRNA Plasmid DNA
cytochrome P450, family 8, subfamily B, polypeptide 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-853s21c1
Sequence:CCGGTCATCCATGCAGGACAAATTTCTCGAGAAATTTGTCCTGCATGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-655s21c1
Sequence:CCGGTTCAGGAAGTTCCGTCGATTTCTCGAGAAATCGACGGAACTTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010012.2-1717s21c1
Sequence:CCGGCATGTGGTCAGCTCAGTTTACCTCGAGGTAAACTGAGCTGACCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-493s21c1
Sequence:CCGGTTGGTGATGCTAGGGCCTAAACTCGAGTTTAGGCCCTAGCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-1121s21c1
Sequence:CCGGGGGTGGTACAGGAGGATTATGCTCGAGCATAATCCTCCTGTACCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-1419s1c1
Sequence:CCGGGATTATGTACTTCGACTTCAACTCGAGTTGAAGTCGAAGTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-666s1c1
Sequence:CCGGCCGTCGATTTGACTTTCTCTTCTCGAGAAGAGAAAGTCAAATCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010012
CYP8B1 MISSION shRNA Lentiviral Transduction Particles
cytochrome P450, family 8, subfamily B, polypeptide 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247894    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-853s21c1
Sequence:CCGGTCATCCATGCAGGACAAATTTCTCGAGAAATTTGTCCTGCATGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-655s21c1
Sequence:CCGGTTCAGGAAGTTCCGTCGATTTCTCGAGAAATCGACGGAACTTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010012.2-1717s21c1
Sequence:CCGGCATGTGGTCAGCTCAGTTTACCTCGAGGTAAACTGAGCTGACCACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-493s21c1
Sequence:CCGGTTGGTGATGCTAGGGCCTAAACTCGAGTTTAGGCCCTAGCATCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010012.2-1121s21c1
Sequence:CCGGGGGTGGTACAGGAGGATTATGCTCGAGCATAATCCTCCTGTACCACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174718    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-1419s1c1
Sequence:CCGGGATTATGTACTTCGACTTCAACTCGAGTTGAAGTCGAAGTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010012.2-666s1c1
Sequence:CCGGCCGTCGATTTGACTTTCTCTTCTCGAGAAGAGAAAGTCAAATCGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks