EMAIL THIS PAGE TO A FRIEND

CYR61

cysteine-rich, angiogenic inducer, 61

65 Gene Product Result for
Synonyms: CCN1 GIG1 IGFBP10
UniProtKB ID: O00622, O14934, O43775, Q9BZL7
Gene ID:
Human(3491) Summary: The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
Mouse(16007) cysteine rich protein 61
Rat(83476) cysteine-rich, angiogenic inducer, 61
Zebrafish(553273) cysteine-rich, angiogenic inducer, 61
Horse(100064066) cysteine-rich, angiogenic inducer, 61
cow(508941) cysteine-rich, angiogenic inducer, 61
domestic cat(101100068) cysteine-rich, angiogenic inducer, 61
chicken(429089) cysteine-rich, angiogenic inducer, 61
dog(479967) cysteine-rich, angiogenic inducer, 61
domestic guinea pig(100734764) cysteine-rich, angiogenic inducer, 61
naked mole-rat(101711249) cysteine-rich, angiogenic inducer, 61
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001554 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010516 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010516 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010516 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001554 Rosetta Predictions human pricing
NM_031327 Rosetta Predictions rat pricing
NM_010516 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045359 predicted 796
2 SASI_Hs01_00045360 predicted 876
3 SASI_Hs02_00332117 predicted 1236
4 SASI_Hs01_00045361 predicted 871
5 SASI_Hs02_00332118 predicted 1111
6 SASI_Hs02_00332119 predicted 1107
7 SASI_Hs01_00045363 predicted 1318
8 SASI_Hs01_00045364 predicted 861
9 SASI_Hs01_00045366 predicted 1319
10 SASI_Hs01_00045368 predicted 857
11 SASI_Hs01_00045362 predicted 990
12 SASI_Hs01_00045365 predicted 785
13 SASI_Hs01_00045367 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058794 predicted 1312
2 SASI_Rn01_00058797 predicted 1217
3 SASI_Rn01_00058798 predicted 1057
4 SASI_Rn01_00058799 predicted 667
5 SASI_Rn01_00058801 predicted 752
6 SASI_Rn01_00058802 predicted 1302
7 SASI_Rn01_00058803 predicted 999
8 SASI_Rn02_00264545 predicted 1103
9 SASI_Rn02_00264546 predicted 971
10 SASI_Rn02_00264547 predicted 331
11 SASI_Rn01_00058795 predicted 1207
12 SASI_Rn01_00058796 predicted 1270
13 SASI_Rn01_00058800 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076881 predicted 342
2 SASI_Mm01_00076882 predicted 1205
3 SASI_Mm02_00318787 predicted 1293
4 SASI_Mm01_00076883 predicted 1277
5 SASI_Mm01_00076884 predicted 977
6 SASI_Mm01_00076885 predicted 480
7 SASI_Mm01_00076886 predicted 1403
8 SASI_Mm01_00076887 predicted 1417
9 SASI_Mm01_00076888 predicted 683
10 SASI_Mm01_00076889 predicted 1169
11 SASI_Mm01_00076890 predicted 1400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001554
CYR61 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich, angiogenic inducer, 61
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1502s21c1
Sequence:CCGGTTGAGGAGCATTAAGGTATTTCTCGAGAAATACCTTAATGCTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001554.4-1351s21c1
Sequence:CCGGTTCACAAATTTAGGGACTAAACTCGAGTTTAGTCCCTAAATTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1839s21c1
Sequence:CCGGGGCAGCTATCTGCACTCTAAACTCGAGTTTAGAGTGCAGATAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001554.3-1846s1c1
Sequence:CCGGGCAAACAGAAATCAGGTGTTTCTCGAGAAACACCTGATTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-860s1c1
Sequence:CCGGCGCATCCTATACAACCCTTTACTCGAGTAAAGGGTTGTATAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1086s1c1
Sequence:CCGGCCGAACCAGTCAGGTTTACTTCTCGAGAAGTAAACCTGACTGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1310s1c1
Sequence:CCGGCCCTTCTACAGGCTGTTCAATCTCGAGATTGAACAGCCTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1087s1c1
Sequence:CCGGCGAACCAGTCAGGTTTACTTACTCGAGTAAGTAAACCTGACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001554
CYR61 MISSION shRNA shRNA Plasmid DNA
cysteine-rich, angiogenic inducer, 61
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1502s21c1
Sequence:CCGGTTGAGGAGCATTAAGGTATTTCTCGAGAAATACCTTAATGCTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001554.4-1351s21c1
Sequence:CCGGTTCACAAATTTAGGGACTAAACTCGAGTTTAGTCCCTAAATTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1839s21c1
Sequence:CCGGGGCAGCTATCTGCACTCTAAACTCGAGTTTAGAGTGCAGATAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001554.3-1846s1c1
Sequence:CCGGGCAAACAGAAATCAGGTGTTTCTCGAGAAACACCTGATTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-860s1c1
Sequence:CCGGCGCATCCTATACAACCCTTTACTCGAGTAAAGGGTTGTATAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1086s1c1
Sequence:CCGGCCGAACCAGTCAGGTTTACTTCTCGAGAAGTAAACCTGACTGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1310s1c1
Sequence:CCGGCCCTTCTACAGGCTGTTCAATCTCGAGATTGAACAGCCTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1087s1c1
Sequence:CCGGCGAACCAGTCAGGTTTACTTACTCGAGTAAGTAAACCTGACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001554
CYR61 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich, angiogenic inducer, 61
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372079    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1502s21c1
Sequence:CCGGTTGAGGAGCATTAAGGTATTTCTCGAGAAATACCTTAATGCTCCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001554.4-1351s21c1
Sequence:CCGGTTCACAAATTTAGGGACTAAACTCGAGTTTAGTCCCTAAATTTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001554.4-1839s21c1
Sequence:CCGGGGCAGCTATCTGCACTCTAAACTCGAGTTTAGAGTGCAGATAGCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118097    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001554.3-1846s1c1
Sequence:CCGGGCAAACAGAAATCAGGTGTTTCTCGAGAAACACCTGATTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-860s1c1
Sequence:CCGGCGCATCCTATACAACCCTTTACTCGAGTAAAGGGTTGTATAGGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1086s1c1
Sequence:CCGGCCGAACCAGTCAGGTTTACTTCTCGAGAAGTAAACCTGACTGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1310s1c1
Sequence:CCGGCCCTTCTACAGGCTGTTCAATCTCGAGATTGAACAGCCTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001554.3-1087s1c1
Sequence:CCGGCGAACCAGTCAGGTTTACTTACTCGAGTAAGTAAACCTGACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010516
CYR61 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich, angiogenic inducer, 61
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-347s21c1
Sequence:CCGGTGCTGTAAGGTCTGCGCTAAACTCGAGTTTAGCGCAGACCTTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-756s21c1
Sequence:CCGGTAACGAGAAACAATGAGTTAACTCGAGTTAACTCATTGTTTCTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-679s21c1
Sequence:CCGGTTGTGATGAAGACAGCATTAACTCGAGTTAATGCTGTCTTCATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010516.2-1430s21c1
Sequence:CCGGTTGAGTAGCATTAGGGTATTTCTCGAGAAATACCCTAATGCTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-1286s21c1
Sequence:CCGGTTCCGACTGTACAGCCTATTCCTCGAGGAATAGGCTGTACAGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-485s1c1
Sequence:CCGGCCTGTGAATATAACTCCAGAACTCGAGTTCTGGAGTTATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1233s1c1
Sequence:CCGGCCAGTCCTGCAAATGTAACTACTCGAGTAGTTACATTTGCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1284s1c1
Sequence:CCGGCCGACTGTACAGCCTATTCAACTCGAGTTGAATAGGCTGTACAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010516.1-1573s1c1
Sequence:CCGGGCGGGCATTATTGCTCCATATCTCGAGATATGGAGCAATAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-484s1c1
Sequence:CCGGCCCTGTGAATATAACTCCAGACTCGAGTCTGGAGTTATATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010516
CYR61 MISSION shRNA shRNA Plasmid DNA
cysteine-rich, angiogenic inducer, 61
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-347s21c1
Sequence:CCGGTGCTGTAAGGTCTGCGCTAAACTCGAGTTTAGCGCAGACCTTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-756s21c1
Sequence:CCGGTAACGAGAAACAATGAGTTAACTCGAGTTAACTCATTGTTTCTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-679s21c1
Sequence:CCGGTTGTGATGAAGACAGCATTAACTCGAGTTAATGCTGTCTTCATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010516.2-1430s21c1
Sequence:CCGGTTGAGTAGCATTAGGGTATTTCTCGAGAAATACCCTAATGCTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-1286s21c1
Sequence:CCGGTTCCGACTGTACAGCCTATTCCTCGAGGAATAGGCTGTACAGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-485s1c1
Sequence:CCGGCCTGTGAATATAACTCCAGAACTCGAGTTCTGGAGTTATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1233s1c1
Sequence:CCGGCCAGTCCTGCAAATGTAACTACTCGAGTAGTTACATTTGCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1284s1c1
Sequence:CCGGCCGACTGTACAGCCTATTCAACTCGAGTTGAATAGGCTGTACAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010516.1-1573s1c1
Sequence:CCGGGCGGGCATTATTGCTCCATATCTCGAGATATGGAGCAATAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-484s1c1
Sequence:CCGGCCCTGTGAATATAACTCCAGACTCGAGTCTGGAGTTATATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010516
CYR61 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich, angiogenic inducer, 61
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-347s21c1
Sequence:CCGGTGCTGTAAGGTCTGCGCTAAACTCGAGTTTAGCGCAGACCTTACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-756s21c1
Sequence:CCGGTAACGAGAAACAATGAGTTAACTCGAGTTAACTCATTGTTTCTCGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-679s21c1
Sequence:CCGGTTGTGATGAAGACAGCATTAACTCGAGTTAATGCTGTCTTCATCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339986    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010516.2-1430s21c1
Sequence:CCGGTTGAGTAGCATTAGGGTATTTCTCGAGAAATACCCTAATGCTACTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010516.2-1286s21c1
Sequence:CCGGTTCCGACTGTACAGCCTATTCCTCGAGGAATAGGCTGTACAGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-485s1c1
Sequence:CCGGCCTGTGAATATAACTCCAGAACTCGAGTTCTGGAGTTATATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1233s1c1
Sequence:CCGGCCAGTCCTGCAAATGTAACTACTCGAGTAGTTACATTTGCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-1284s1c1
Sequence:CCGGCCGACTGTACAGCCTATTCAACTCGAGTTGAATAGGCTGTACAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088183    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010516.1-1573s1c1
Sequence:CCGGGCGGGCATTATTGCTCCATATCTCGAGATATGGAGCAATAATGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010516.1-484s1c1
Sequence:CCGGCCCTGTGAATATAACTCCAGACTCGAGTCTGGAGTTATATTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks