EMAIL THIS PAGE TO A FRIEND

CYS1

cystin 1

60 Gene Product Result for
Species: Human CYS1(192668), Mouse Cys1(12879), Rat Cys1(690489), Thale Cress CYS1(831087), domestic guinea pig Cys1(101787909)
UniProtKB ID: Q717R9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001037160 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001037160 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001037160 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220391 MISSION® esiRNA esiRNA targeting human CYS1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037160 Rosetta Predictions human pricing
NM_001109597 Rosetta Predictions rat pricing
NM_001004455 Rosetta Predictions mouse pricing
NM_138686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037160 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308221 predicted 495
2 SASI_Hs01_00036974 predicted 583
3 SASI_Hs01_00036975 predicted 585
4 SASI_Hs01_00036976 predicted 503
5 SASI_Hs01_00036977 predicted 647
6 SASI_Hs01_00036978 predicted 198
7 SASI_Hs01_00036979 predicted 646
8 SASI_Hs01_00036980 predicted 496
9 SASI_Hs01_00036982 predicted 711
10 SASI_Hs02_00308222 predicted 718
11 SASI_Hs01_00036981 predicted 748
12 SASI_Hs01_00036983 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109597 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00249937 predicted 1362
2 SASI_Rn02_00249938 predicted 1545
3 SASI_Rn02_00249939 predicted 1450
4 SASI_Rn02_00249940 predicted 1458
5 SASI_Rn02_00249941 predicted 1565
6 SASI_Rn02_00249942 predicted 1374
7 SASI_Rn02_00249943 predicted 1470
8 SASI_Rn02_00249944 predicted 1381
9 SASI_Rn02_00249945 predicted 1030
10 SASI_Rn02_00249946 predicted 1499
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039811 predicted 1067
2 SASI_Mm01_00039812 predicted 935
3 SASI_Mm01_00039813 predicted 949
4 SASI_Mm01_00039814 predicted 948
5 SASI_Mm01_00039815 predicted 1069
6 SASI_Mm01_00039816 predicted 972
7 SASI_Mm01_00039817 predicted 896
8 SASI_Mm01_00039818 predicted 1058
9 SASI_Mm01_00039819 predicted 1061
10 SASI_Mm01_00039820 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339774 predicted 1068
2 SASI_Mm02_00339775 predicted 928
3 SASI_Mm02_00339776 predicted 943
4 SASI_Mm02_00339777 predicted 948
5 SASI_Mm02_00339778 predicted 1072
6 SASI_Mm02_00339779 predicted 968
7 SASI_Mm02_00339780 predicted 900
8 SASI_Mm02_00339781 predicted 1061
9 SASI_Mm02_00339782 predicted 1058
10 SASI_Mm02_00339783 predicted 942
11 SASI_Mm01_00060907 predicted 1430
12 SASI_Mm01_00060908 predicted 1612
13 SASI_Mm01_00060909 predicted 1606
14 SASI_Mm01_00060910 predicted 1425
15 SASI_Mm01_00060911 predicted 1588
16 SASI_Mm01_00060912 predicted 1387
17 SASI_Mm01_00060913 predicted 1592
18 SASI_Mm01_00060914 predicted 1421
19 SASI_Mm01_00060915 predicted 1548
20 SASI_Mm01_00060916 predicted 1407
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138686
CYS1 MISSION shRNA Bacterial Glycerol Stock
cystin 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1278s1c1
Sequence:CCGGGCCATCTCCTATGACTACTCACTCGAGTGAGTAGTCATAGGAGATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1199s1c1
Sequence:CCGGGAAGGTTAAAGGCAACCCTGACTCGAGTCAGGGTTGCCTTTAACCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1194s1c1
Sequence:CCGGGAGAAGAAGGTTAAAGGCAACCTCGAGGTTGCCTTTAACCTTCTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1283s1c1
Sequence:CCGGCTCCTATGACTACTCAGAAGACTCGAGTCTTCTGAGTAGTCATAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1280s1c1
Sequence:CCGGCATCTCCTATGACTACTCAGACTCGAGTCTGAGTAGTCATAGGAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1192s1c1
Sequence:CCGGCAGAGAAGAAGGTTAAAGGCACTCGAGTGCCTTTAACCTTCTTCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1514s1c1
Sequence:CCGGCAGAACACAACCTAGAGTATCCTCGAGGATACTCTAGGTTGTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1621s1c1
Sequence:CCGGGACTTGACAAGAGTACCTTTGCTCGAGCAAAGGTACTCTTGTCAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138686
CYS1 MISSION shRNA shRNA Plasmid DNA
cystin 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1278s1c1
Sequence:CCGGGCCATCTCCTATGACTACTCACTCGAGTGAGTAGTCATAGGAGATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1199s1c1
Sequence:CCGGGAAGGTTAAAGGCAACCCTGACTCGAGTCAGGGTTGCCTTTAACCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1194s1c1
Sequence:CCGGGAGAAGAAGGTTAAAGGCAACCTCGAGGTTGCCTTTAACCTTCTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1283s1c1
Sequence:CCGGCTCCTATGACTACTCAGAAGACTCGAGTCTTCTGAGTAGTCATAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1280s1c1
Sequence:CCGGCATCTCCTATGACTACTCAGACTCGAGTCTGAGTAGTCATAGGAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1192s1c1
Sequence:CCGGCAGAGAAGAAGGTTAAAGGCACTCGAGTGCCTTTAACCTTCTTCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1514s1c1
Sequence:CCGGCAGAACACAACCTAGAGTATCCTCGAGGATACTCTAGGTTGTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1621s1c1
Sequence:CCGGGACTTGACAAGAGTACCTTTGCTCGAGCAAAGGTACTCTTGTCAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138686
CYS1 MISSION shRNA Lentiviral Transduction Particles
cystin 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1278s1c1
Sequence:CCGGGCCATCTCCTATGACTACTCACTCGAGTGAGTAGTCATAGGAGATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138686.1-1199s1c1
Sequence:CCGGGAAGGTTAAAGGCAACCCTGACTCGAGTCAGGGTTGCCTTTAACCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1194s1c1
Sequence:CCGGGAGAAGAAGGTTAAAGGCAACCTCGAGGTTGCCTTTAACCTTCTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1283s1c1
Sequence:CCGGCTCCTATGACTACTCAGAAGACTCGAGTCTTCTGAGTAGTCATAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1280s1c1
Sequence:CCGGCATCTCCTATGACTACTCAGACTCGAGTCTGAGTAGTCATAGGAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138686.1-1192s1c1
Sequence:CCGGCAGAGAAGAAGGTTAAAGGCACTCGAGTGCCTTTAACCTTCTTCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217022    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1514s1c1
Sequence:CCGGCAGAACACAACCTAGAGTATCCTCGAGGATACTCTAGGTTGTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217596    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_138686.3-1621s1c1
Sequence:CCGGGACTTGACAAGAGTACCTTTGCTCGAGCAAAGGTACTCTTGTCAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001037160
CYS1 MISSION shRNA Bacterial Glycerol Stock
cystin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-765s21c1
Sequence:CCGGACGCAGTCACTCCCGGATATTCTCGAGAATATCCGGGAGTGACTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1139s21c1
Sequence:CCGGTTAGTGCTTCTCAACTTTAACCTCGAGGTTAAAGTTGAGAAGCACTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1201s21c1
Sequence:CCGGCTGAGGTTCTGTACGTCTAACCTCGAGGTTAGACGTACAGAACCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2282s21c1
Sequence:CCGGATGGAAGTCGTTACTATATTTCTCGAGAAATATAGTAACGACTTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2479s21c1
Sequence:CCGGATACCCTTAATGAGATCAAAGCTCGAGCTTTGATCTCATTAAGGGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001037160
CYS1 MISSION shRNA shRNA Plasmid DNA
cystin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-765s21c1
Sequence:CCGGACGCAGTCACTCCCGGATATTCTCGAGAATATCCGGGAGTGACTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1139s21c1
Sequence:CCGGTTAGTGCTTCTCAACTTTAACCTCGAGGTTAAAGTTGAGAAGCACTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1201s21c1
Sequence:CCGGCTGAGGTTCTGTACGTCTAACCTCGAGGTTAGACGTACAGAACCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2282s21c1
Sequence:CCGGATGGAAGTCGTTACTATATTTCTCGAGAAATATAGTAACGACTTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2479s21c1
Sequence:CCGGATACCCTTAATGAGATCAAAGCTCGAGCTTTGATCTCATTAAGGGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001037160
CYS1 MISSION shRNA Lentiviral Transduction Particles
cystin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-765s21c1
Sequence:CCGGACGCAGTCACTCCCGGATATTCTCGAGAATATCCGGGAGTGACTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265674    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1139s21c1
Sequence:CCGGTTAGTGCTTCTCAACTTTAACCTCGAGGTTAAAGTTGAGAAGCACTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-1201s21c1
Sequence:CCGGCTGAGGTTCTGTACGTCTAACCTCGAGGTTAGACGTACAGAACCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2282s21c1
Sequence:CCGGATGGAAGTCGTTACTATATTTCTCGAGAAATATAGTAACGACTTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001037160.2-2479s21c1
Sequence:CCGGATACCCTTAATGAGATCAAAGCTCGAGCTTTGATCTCATTAAGGGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)