EMAIL THIS PAGE TO A FRIEND

CYSLTR1

cysteinyl leukotriene receptor 1

55 Gene Product Result for
Synonyms: CYSLT1 CYSLT1R CYSLTR HMTMF81
UniProtKB ID: Q9Y271, B2R954, D3DTE4, Q5JS94, Q8IV19
Gene ID:
Human(10800) Summary: The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR2. This encoded receptor is a member of the superfamily of G protein-coupled receptors. Activation of this receptor by LTD4 results in contraction and proliferation of smooth muscle, oedema, eosinophil migration and damage to the mucus layer in the lung. [provided by RefSeq, Jul 2008]
Mouse(58861) cysteinyl leukotriene receptor 1
Rat(114099) cysteinyl leukotriene receptor 1
domestic guinea pig(100135514) cysteinyl leukotriene receptor 1
naked mole-rat(101713226) cysteinyl leukotriene receptor 1
Zebrafish(553675) cysteinyl leukotriene receptor 1
dog(100686426) cysteinyl leukotriene receptor 1
cow(782045) cysteinyl leukotriene receptor 1
domestic cat(101087714) cysteinyl leukotriene receptor 1
dog(608345) cysteinyl leukotriene receptor 1
chicken(428691) cysteinyl leukotriene receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
S7690 SR 2640 ≥99% (HPLC), solid human pricing

Small Molecule - Ligand

Product # Description Species Add to Cart
 
C6239 Cinalukast ~98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006639 Rosetta Predictions human pricing
NM_053641 Rosetta Predictions rat pricing
NM_021476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00180347 predicted 810
2 SASI_Hs01_00180348 predicted 692
3 SASI_Hs01_00180349 predicted 435
4 SASI_Hs02_00341997 predicted 683
5 SASI_Hs01_00180350 predicted 497
6 SASI_Hs01_00180351 predicted 710
7 SASI_Hs01_00180352 predicted 412
8 SASI_Hs01_00180353 predicted 478
9 SASI_Hs01_00180354 predicted 448
10 SASI_Hs01_00180355 predicted 522
11 SASI_Hs01_00180356 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110464 predicted 693
2 SASI_Rn01_00110465 predicted 568
3 SASI_Rn01_00110466 predicted 628
4 SASI_Rn01_00110467 predicted 303
5 SASI_Rn01_00110468 predicted 319
6 SASI_Rn01_00110469 predicted 762
7 SASI_Rn01_00110471 predicted 697
8 SASI_Rn01_00110472 predicted 740
9 SASI_Rn01_00110473 predicted 620
10 SASI_Rn02_00266365 predicted 199
11 SASI_Rn01_00110470 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038902 predicted 746
2 SASI_Mm01_00038903 predicted 476
3 SASI_Mm01_00038904 predicted 1059
4 SASI_Mm01_00038905 predicted 1230
5 SASI_Mm02_00326161 predicted 949
6 SASI_Mm01_00038907 predicted 1052
7 SASI_Mm01_00038909 predicted 1221
8 SASI_Mm01_00038910 predicted 1164
9 SASI_Mm01_00038911 predicted 1120
10 SASI_Mm02_00326162 predicted 742
11 SASI_Mm01_00038906 predicted 862
12 SASI_Mm01_00038908 predicted 506
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006639
CYSLTR1 MISSION shRNA Bacterial Glycerol Stock
cysteinyl leukotriene receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-630s21c1
Sequence:CCGGCTCTCCGTGTGGTCTATTATGCTCGAGCATAATAGACCACACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1267s21c1
Sequence:CCGGCTTTGACCCTCTCCTATATTTCTCGAGAAATATAGGAGAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1020s21c1
Sequence:CCGGTCTGTTACACAATGATCATTTCTCGAGAAATGATCATTGTGTAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1197s1c1
Sequence:CCGGCCTGTGATTCTGTCCTTAGAACTCGAGTTCTAAGGACAGAATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-704s1c1
Sequence:CCGGGCTTTGTATGTCAACCTCTATCTCGAGATAGAGGTTGACATACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-629s1c1
Sequence:CCGGCCTCTCCGTGTGGTCTATTATCTCGAGATAATAGACCACACGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-442s1c1
Sequence:CCGGCCATGACACTATTGATGACTTCTCGAGAAGTCATCAATAGTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1347s1c1
Sequence:CCGGGCGTGACTTATGTACCCAGAACTCGAGTTCTGGGTACATAAGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006639
CYSLTR1 MISSION shRNA shRNA Plasmid DNA
cysteinyl leukotriene receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-630s21c1
Sequence:CCGGCTCTCCGTGTGGTCTATTATGCTCGAGCATAATAGACCACACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1267s21c1
Sequence:CCGGCTTTGACCCTCTCCTATATTTCTCGAGAAATATAGGAGAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1020s21c1
Sequence:CCGGTCTGTTACACAATGATCATTTCTCGAGAAATGATCATTGTGTAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1197s1c1
Sequence:CCGGCCTGTGATTCTGTCCTTAGAACTCGAGTTCTAAGGACAGAATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-704s1c1
Sequence:CCGGGCTTTGTATGTCAACCTCTATCTCGAGATAGAGGTTGACATACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-629s1c1
Sequence:CCGGCCTCTCCGTGTGGTCTATTATCTCGAGATAATAGACCACACGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-442s1c1
Sequence:CCGGCCATGACACTATTGATGACTTCTCGAGAAGTCATCAATAGTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1347s1c1
Sequence:CCGGGCGTGACTTATGTACCCAGAACTCGAGTTCTGGGTACATAAGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006639
CYSLTR1 MISSION shRNA Lentiviral Transduction Particles
cysteinyl leukotriene receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-630s21c1
Sequence:CCGGCTCTCCGTGTGGTCTATTATGCTCGAGCATAATAGACCACACGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1267s21c1
Sequence:CCGGCTTTGACCCTCTCCTATATTTCTCGAGAAATATAGGAGAGGGTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006639.2-1020s21c1
Sequence:CCGGTCTGTTACACAATGATCATTTCTCGAGAAATGATCATTGTGTAACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1197s1c1
Sequence:CCGGCCTGTGATTCTGTCCTTAGAACTCGAGTTCTAAGGACAGAATCACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-704s1c1
Sequence:CCGGGCTTTGTATGTCAACCTCTATCTCGAGATAGAGGTTGACATACAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-629s1c1
Sequence:CCGGCCTCTCCGTGTGGTCTATTATCTCGAGATAATAGACCACACGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011326    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-442s1c1
Sequence:CCGGCCATGACACTATTGATGACTTCTCGAGAAGTCATCAATAGTGTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006639.2-1347s1c1
Sequence:CCGGGCGTGACTTATGTACCCAGAACTCGAGTTCTGGGTACATAAGTCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021476
CYSLTR1 MISSION shRNA Bacterial Glycerol Stock
cysteinyl leukotriene receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-428s1c1
Sequence:CCGGAGAACATGAATGGAACTGAAACTCGAGTTTCAGTTCCATTCATGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-967s1c1
Sequence:CCGGCCACAGAACAATCAAGCTAAACTCGAGTTTAGCTTGATTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1168s1c1
Sequence:CCGGGTGAGCTTCATGCCATATCATCTCGAGATGATATGGCATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1288s1c1
Sequence:CCGGGCTGCATCAAATTGTTGCTTTCTCGAGAAAGCAACAATTTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-756s1c1
Sequence:CCGGCCTCTATTGTAGCATCTTCTTCTCGAGAAGAAGATGCTACAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021476
CYSLTR1 MISSION shRNA shRNA Plasmid DNA
cysteinyl leukotriene receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-428s1c1
Sequence:CCGGAGAACATGAATGGAACTGAAACTCGAGTTTCAGTTCCATTCATGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-967s1c1
Sequence:CCGGCCACAGAACAATCAAGCTAAACTCGAGTTTAGCTTGATTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1168s1c1
Sequence:CCGGGTGAGCTTCATGCCATATCATCTCGAGATGATATGGCATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1288s1c1
Sequence:CCGGGCTGCATCAAATTGTTGCTTTCTCGAGAAAGCAACAATTTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-756s1c1
Sequence:CCGGCCTCTATTGTAGCATCTTCTTCTCGAGAAGAAGATGCTACAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021476
CYSLTR1 MISSION shRNA Lentiviral Transduction Particles
cysteinyl leukotriene receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-428s1c1
Sequence:CCGGAGAACATGAATGGAACTGAAACTCGAGTTTCAGTTCCATTCATGTTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-967s1c1
Sequence:CCGGCCACAGAACAATCAAGCTAAACTCGAGTTTAGCTTGATTGTTCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1168s1c1
Sequence:CCGGGTGAGCTTCATGCCATATCATCTCGAGATGATATGGCATGAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-1288s1c1
Sequence:CCGGGCTGCATCAAATTGTTGCTTTCTCGAGAAAGCAACAATTTGATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021476.2-756s1c1
Sequence:CCGGCCTCTATTGTAGCATCTTCTTCTCGAGAAGAAGATGCTACAATAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks