EMAIL THIS PAGE TO A FRIEND

CYSLTR2

cysteinyl leukotriene receptor 2

104 Gene Product Result for
Synonyms: CYSLT2 CYSLT2R HG57 HPN321 KPG_011 hGPCR21
UniProtKB ID: Q9NS75, Q9HCQ2
Gene ID:
Human(57105) Summary: The cysteinyl leukotrienes LTC4, LTD4, and LTE4 are important mediators of human bronchial asthma. Pharmacologic studies have determined that cysteinyl leukotrienes activate at least 2 receptors, the protein encoded by this gene and CYSLTR1. This encoded receptor is a member of the superfamily of G protein-coupled receptors. It seems to play a major role in endocrine and cardiovascular systems. [provided by RefSeq, Jul 2008]
Mouse(70086) cysteinyl leukotriene receptor 2
Rat(170926) cysteinyl leukotriene receptor 2
chicken(428071) cysteinyl leukotriene receptor 2
cow(540387) cysteinyl leukotriene receptor 2
domestic cat(101094975) cysteinyl leukotriene receptor 2
dog(485445) cysteinyl leukotriene receptor 2
domestic guinea pig(100379529) cysteinyl leukotriene receptor 2
sheep(101114623) cysteinyl leukotriene receptor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133720 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133720 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133720 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020377 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020377 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020377 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020377 Rosetta Predictions human pricing
NM_133413 Rosetta Predictions rat pricing
NM_133720 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020377 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129696 predicted 358
2 SASI_Hs01_00129697 predicted 344
3 SASI_Hs01_00129698 predicted 489
4 SASI_Hs01_00129699 predicted 1129
5 SASI_Hs01_00129700 predicted 336
6 SASI_Hs01_00129701 predicted 1117
7 SASI_Hs02_00353336 predicted 737
8 SASI_Hs01_00129702 predicted 996
9 SASI_Hs01_00129703 predicted 1040
10 SASI_Hs01_00129704 predicted 561
11 SASI_Hs01_00129705 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133413 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085720 predicted 419
2 SASI_Rn01_00085722 predicted 508
3 SASI_Rn01_00085723 predicted 316
4 SASI_Rn01_00085724 predicted 278
5 SASI_Rn01_00085725 predicted 677
6 SASI_Rn01_00085726 predicted 293
7 SASI_Rn01_00085728 predicted 541
8 SASI_Rn01_00085729 predicted 229
9 SASI_Rn02_00267668 predicted 381
10 SASI_Rn02_00267669 predicted 418
11 SASI_Rn01_00085721 predicted 687
12 SASI_Rn01_00085727 predicted 294
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133720 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068355 predicted 740
2 SASI_Mm01_00068356 predicted 1492
3 SASI_Mm02_00338690 predicted 1248
4 SASI_Mm01_00068358 predicted 932
5 SASI_Mm01_00068359 predicted 1237
6 SASI_Mm02_00338691 predicted 1464
7 SASI_Mm01_00068361 predicted 767
8 SASI_Mm01_00068362 predicted 1104
9 SASI_Mm01_00068363 predicted 1527
10 SASI_Mm01_00068364 predicted 928
11 SASI_Mm01_00068357 predicted 1524
12 SASI_Mm01_00068360 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133720
CYSLTR2 MISSION shRNA Bacterial Glycerol Stock
cysteinyl leukotriene receptor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1524s1c1
Sequence:CCGGGCTATATTCAGCAAAGTTCATCTCGAGATGAACTTTGCTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-930s1c1
Sequence:CCGGGTCAACATGTATACTAGCATTCTCGAGAATGCTAGTATACATGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1103s1c1
Sequence:CCGGCCAAGAGGAGAAAGATAACATCTCGAGATGTTATCTTTCTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1418s1c1
Sequence:CCGGGCTACATAAGGCCACAGTCATCTCGAGATGACTGTGGCCTTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-696s1c1
Sequence:CCGGCCCATCATATACCTGATAATACTCGAGTATTATCAGGTATATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133720
CYSLTR2 MISSION shRNA shRNA Plasmid DNA
cysteinyl leukotriene receptor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1524s1c1
Sequence:CCGGGCTATATTCAGCAAAGTTCATCTCGAGATGAACTTTGCTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-930s1c1
Sequence:CCGGGTCAACATGTATACTAGCATTCTCGAGAATGCTAGTATACATGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1103s1c1
Sequence:CCGGCCAAGAGGAGAAAGATAACATCTCGAGATGTTATCTTTCTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1418s1c1
Sequence:CCGGGCTACATAAGGCCACAGTCATCTCGAGATGACTGTGGCCTTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-696s1c1
Sequence:CCGGCCCATCATATACCTGATAATACTCGAGTATTATCAGGTATATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133720
CYSLTR2 MISSION shRNA Lentiviral Transduction Particles
cysteinyl leukotriene receptor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1524s1c1
Sequence:CCGGGCTATATTCAGCAAAGTTCATCTCGAGATGAACTTTGCTGAATATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-930s1c1
Sequence:CCGGGTCAACATGTATACTAGCATTCTCGAGAATGCTAGTATACATGTTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1103s1c1
Sequence:CCGGCCAAGAGGAGAAAGATAACATCTCGAGATGTTATCTTTCTCCTCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-1418s1c1
Sequence:CCGGGCTACATAAGGCCACAGTCATCTCGAGATGACTGTGGCCTTATGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133720.1-696s1c1
Sequence:CCGGCCCATCATATACCTGATAATACTCGAGTATTATCAGGTATATGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020377
CYSLTR2 MISSION shRNA Bacterial Glycerol Stock
cysteinyl leukotriene receptor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-899s1c1
Sequence:CCGGGCTTCAATCCTCTGCTCTATTCTCGAGAATAGAGCAGAGGATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-332s1c1
Sequence:CCGGCCTGCAGGATTATGTCTTATTCTCGAGAATAAGACATAATCCTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-495s1c1
Sequence:CCGGCCTTATCATGGCTTCCTCAATCTCGAGATTGAGGAAGCCATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-42s1c1
Sequence:CCGGCGTATCAGAAATGGAACCAAACTCGAGTTTGGTTCCATTTCTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020377.2-1132s1c1
Sequence:CCGGCCCAACAAATGTTGATTCTTACTCGAGTAAGAATCAACATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-166s21c1
Sequence:CCGGGGAAATGGGTTGTCCATATATCTCGAGATATATGGACAACCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-901s21c1
Sequence:CCGGTTCAATCCTCTGCTCTATTACCTCGAGGTAATAGAGCAGAGGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-277s21c1
Sequence:CCGGCCCTTCAGGGCTGACTATTATCTCGAGATAATAGTCAGCCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020377
CYSLTR2 MISSION shRNA shRNA Plasmid DNA
cysteinyl leukotriene receptor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-899s1c1
Sequence:CCGGGCTTCAATCCTCTGCTCTATTCTCGAGAATAGAGCAGAGGATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-332s1c1
Sequence:CCGGCCTGCAGGATTATGTCTTATTCTCGAGAATAAGACATAATCCTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-495s1c1
Sequence:CCGGCCTTATCATGGCTTCCTCAATCTCGAGATTGAGGAAGCCATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-42s1c1
Sequence:CCGGCGTATCAGAAATGGAACCAAACTCGAGTTTGGTTCCATTTCTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020377.2-1132s1c1
Sequence:CCGGCCCAACAAATGTTGATTCTTACTCGAGTAAGAATCAACATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-166s21c1
Sequence:CCGGGGAAATGGGTTGTCCATATATCTCGAGATATATGGACAACCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-901s21c1
Sequence:CCGGTTCAATCCTCTGCTCTATTACCTCGAGGTAATAGAGCAGAGGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-277s21c1
Sequence:CCGGCCCTTCAGGGCTGACTATTATCTCGAGATAATAGTCAGCCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020377
CYSLTR2 MISSION shRNA Lentiviral Transduction Particles
cysteinyl leukotriene receptor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-899s1c1
Sequence:CCGGGCTTCAATCCTCTGCTCTATTCTCGAGAATAGAGCAGAGGATTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-332s1c1
Sequence:CCGGCCTGCAGGATTATGTCTTATTCTCGAGAATAAGACATAATCCTGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-495s1c1
Sequence:CCGGCCTTATCATGGCTTCCTCAATCTCGAGATTGAGGAAGCCATGATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020377.2-42s1c1
Sequence:CCGGCGTATCAGAAATGGAACCAAACTCGAGTTTGGTTCCATTTCTGATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011329    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020377.2-1132s1c1
Sequence:CCGGCCCAACAAATGTTGATTCTTACTCGAGTAAGAATCAACATTTGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-166s21c1
Sequence:CCGGGGAAATGGGTTGTCCATATATCTCGAGATATATGGACAACCCATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-901s21c1
Sequence:CCGGTTCAATCCTCTGCTCTATTACCTCGAGGTAATAGAGCAGAGGATTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020377.2-277s21c1
Sequence:CCGGCCCTTCAGGGCTGACTATTATCTCGAGATAATAGTCAGCCCTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks