EMAIL THIS PAGE TO A FRIEND

CYSTM1

cysteine-rich transmembrane module containing 1

71 Gene Product Result for
Synonyms: C5orf32
UniProtKB ID: Q9H1C7, Q8TBA5
Gene ID:
Mouse(66060) cysteine-rich transmembrane module containing 1
Rat(100363310) cysteine-rich transmembrane module containing 1
naked mole-rat(101714591) cysteine-rich transmembrane module containing 1
sheep(101117583) cysteine-rich transmembrane module containing 1
chicken(769167) chromosome 13 open reading frame, human C5orf32
dog(100683654) cysteine-rich transmembrane module containing 1
cow(777789) cysteine-rich transmembrane module containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032412 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081365 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081365 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081365 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032412 Rosetta Predictions human pricing
NM_001081365 Rosetta Predictions mouse pricing
XM_900215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021470 predicted 412
2 SASI_Hs02_00359807 predicted 495
3 SASI_Hs01_00021471 predicted 423
4 SASI_Hs01_00021472 predicted 420
5 SASI_Hs02_00359808 predicted 540
6 SASI_Hs01_00021474 predicted 293
7 SASI_Hs01_00021476 predicted 304
8 SASI_Hs01_00021477 predicted 307
9 SASI_Hs01_00021478 predicted 309
10 SASI_Hs02_00359809 predicted 237
11 SASI_Hs01_00021473 predicted 204
12 SASI_Hs01_00021475 predicted 394
13 SASI_Hs01_00021479 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297701 predicted 254
2 SASI_Mm02_00297702 predicted 252
3 SASI_Mm02_00297703 predicted 212
4 SASI_Mm02_00297704 predicted 263
5 SASI_Mm02_00297705 predicted 257
6 SASI_Mm02_00297706 predicted 216
7 SASI_Mm02_00297707 predicted 405
8 SASI_Mm02_00297708 predicted 398
9 SASI_Mm02_00297709 predicted 449
10 SASI_Mm02_00297710 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212556 predicted 265
2 SASI_Mm01_00212557 predicted 267
3 SASI_Mm01_00212558 predicted 225
4 SASI_Mm01_00212559 predicted 264
5 SASI_Mm01_00212560 predicted 268
6 SASI_Mm01_00212561 predicted 226
7 SASI_Mm01_00212562 predicted 413
8 SASI_Mm01_00212563 predicted 407
9 SASI_Mm01_00212564 predicted 456
10 SASI_Mm01_00212565 predicted 398
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032412
VALIDATED
CYSTM1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich transmembrane module containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032412.3-615s21c1
Sequence:CCGGGTTAACAAATGACTAGCTTTGCTCGAGCAAAGCTAGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-507s1c1
Sequence:CCGGCCATCTCTTCTGATTGCTGTTCTCGAGAACAGCAATCAGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-204s1c1
Sequence:CCGGCACCTTATCCACCACAACCAACTCGAGTTGGTTGTGGTGGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-357s1c1
Sequence:CCGGGAAGAGATGAGCTAGGACCATCTCGAGATGGTCCTAGCTCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-273s1c1
Sequence:CCGGCCTACCAAGGATACCCACAGTCTCGAGACTGTGGGTATCCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-336s1c1
Sequence:CCGGTGTATGTGGTAGAAGACCAAACTCGAGTTTGGTCTTCTACCACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032412
VALIDATED
CYSTM1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich transmembrane module containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032412.3-615s21c1
Sequence:CCGGGTTAACAAATGACTAGCTTTGCTCGAGCAAAGCTAGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-507s1c1
Sequence:CCGGCCATCTCTTCTGATTGCTGTTCTCGAGAACAGCAATCAGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-204s1c1
Sequence:CCGGCACCTTATCCACCACAACCAACTCGAGTTGGTTGTGGTGGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-357s1c1
Sequence:CCGGGAAGAGATGAGCTAGGACCATCTCGAGATGGTCCTAGCTCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-273s1c1
Sequence:CCGGCCTACCAAGGATACCCACAGTCTCGAGACTGTGGGTATCCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-336s1c1
Sequence:CCGGTGTATGTGGTAGAAGACCAAACTCGAGTTTGGTCTTCTACCACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032412
VALIDATED
CYSTM1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich transmembrane module containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418202    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032412.3-615s21c1
Sequence:CCGGGTTAACAAATGACTAGCTTTGCTCGAGCAAAGCTAGTCATTTGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077963    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-507s1c1
Sequence:CCGGCCATCTCTTCTGATTGCTGTTCTCGAGAACAGCAATCAGAAGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-204s1c1
Sequence:CCGGCACCTTATCCACCACAACCAACTCGAGTTGGTTGTGGTGGATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-357s1c1
Sequence:CCGGGAAGAGATGAGCTAGGACCATCTCGAGATGGTCCTAGCTCATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-273s1c1
Sequence:CCGGCCTACCAAGGATACCCACAGTCTCGAGACTGTGGGTATCCTTGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032412.2-336s1c1
Sequence:CCGGTGTATGTGGTAGAAGACCAAACTCGAGTTTGGTCTTCTACCACATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081365
VALIDATED
CYSTM1 MISSION shRNA Bacterial Glycerol Stock
cysteine-rich transmembrane module containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-408s21c1
Sequence:CCGGCCTAAGACCACAGTGTACATTCTCGAGAATGTACACTGTGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081365.1-359s21c1
Sequence:CCGGCTATCAAGGATACCCACAGTACTCGAGTACTGTGGGTATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-261s21c1
Sequence:CCGGCCATACCCACCTTATCCACAACTCGAGTTGTGGATAAGGTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-394s21c1
Sequence:CCGGGACCTCAGGAGCCTCCTAAGACTCGAGTCTTAGGAGGCTCCTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-270s21c1
Sequence:CCGGCCTTATCCACAACAGCCAATGCTCGAGCATTGGCTGTTGTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081365
VALIDATED
CYSTM1 MISSION shRNA shRNA Plasmid DNA
cysteine-rich transmembrane module containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-408s21c1
Sequence:CCGGCCTAAGACCACAGTGTACATTCTCGAGAATGTACACTGTGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081365.1-359s21c1
Sequence:CCGGCTATCAAGGATACCCACAGTACTCGAGTACTGTGGGTATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-261s21c1
Sequence:CCGGCCATACCCACCTTATCCACAACTCGAGTTGTGGATAAGGTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-394s21c1
Sequence:CCGGGACCTCAGGAGCCTCCTAAGACTCGAGTCTTAGGAGGCTCCTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-270s21c1
Sequence:CCGGCCTTATCCACAACAGCCAATGCTCGAGCATTGGCTGTTGTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081365
VALIDATED
CYSTM1 MISSION shRNA Lentiviral Transduction Particles
cysteine-rich transmembrane module containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-408s21c1
Sequence:CCGGCCTAAGACCACAGTGTACATTCTCGAGAATGTACACTGTGGTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081365.1-359s21c1
Sequence:CCGGCTATCAAGGATACCCACAGTACTCGAGTACTGTGGGTATCCTTGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-261s21c1
Sequence:CCGGCCATACCCACCTTATCCACAACTCGAGTTGTGGATAAGGTGGGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-394s21c1
Sequence:CCGGGACCTCAGGAGCCTCCTAAGACTCGAGTCTTAGGAGGCTCCTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081365.1-270s21c1
Sequence:CCGGCCTTATCCACAACAGCCAATGCTCGAGCATTGGCTGTTGTGGATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks