EMAIL THIS PAGE TO A FRIEND

CYTH1

cytohesin 1

130 Gene Product Result for
Synonyms: B2-1 CYTOHESIN-1 D17S811E PSCD1 SEC7
UniProtKB ID: Q15438, A6NFW7, Q9P123, Q9P124
Gene ID:
Human(9267) Summary: The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. The encoded protein is 83% homologous to that of CYTH2. [provided by RefSeq, Aug 2008]
Mouse(19157) cytohesin 1
Rat(116691) cytohesin 1
chicken(422085) cytohesin 1
cow(100141038) cytohesin 1
Horse(100057600) cytohesin 1
dog(608079) cytohesin 1
sheep(101112995) cytohesin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004762 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004762 Rosetta Predictions human pricing
NM_017456 Rosetta Predictions human pricing
NM_053910 Rosetta Predictions rat pricing
NM_001112699 Rosetta Predictions mouse pricing
NM_001112700 Rosetta Predictions mouse pricing
NM_011180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338250 predicted 419
2 SASI_Hs01_00026672 predicted 561
3 SASI_Hs01_00026673 predicted 610
4 SASI_Hs02_00338251 predicted 339
5 SASI_Hs01_00026674 predicted 601
6 SASI_Hs02_00338252 predicted 622
7 SASI_Hs01_00026675 predicted 366
8 SASI_Hs02_00338253 predicted 1125
9 SASI_Hs01_00026676 predicted 581
10 SASI_Hs02_00338254 predicted 1160
11 SASI_Hs01_00026677 predicted 597
12 SASI_Hs01_00026678 predicted 350
13 SASI_Hs01_00026679 predicted 977
14 SASI_Hs01_00026680 predicted 983
15 SASI_Hs01_00026681 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350079 predicted 414
2 SASI_Hs01_00014904 predicted 562
3 SASI_Hs01_00014905 predicted 613
4 SASI_Hs02_00350080 predicted 348
5 SASI_Hs01_00014906 predicted 596
6 SASI_Hs02_00350081 predicted 624
7 SASI_Hs01_00014907 predicted 365
8 SASI_Hs02_00350082 predicted 1114
9 SASI_Hs01_00014908 predicted 573
10 SASI_Hs02_00350083 predicted 1159
11 SASI_Hs01_00014909 predicted 594
12 SASI_Hs01_00014910 predicted 360
13 SASI_Hs01_00014911 predicted 969
14 SASI_Hs01_00014912 predicted 976
15 SASI_Hs01_00014913 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266842 predicted 936
2 SASI_Rn01_00082821 predicted 1072
3 SASI_Rn01_00082822 predicted 1027
4 SASI_Rn01_00082823 predicted 927
5 SASI_Rn01_00082824 predicted 351
6 SASI_Rn02_00266843 predicted 1045
7 SASI_Rn01_00082825 predicted 428
8 SASI_Rn01_00082826 predicted 1056
9 SASI_Rn01_00082829 predicted 250
10 SASI_Rn02_00266844 predicted 610
11 SASI_Rn01_00082820 predicted 625
12 SASI_Rn01_00082827 predicted 351
13 SASI_Rn01_00082828 predicted 908
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306913 predicted 1267
2 SASI_Mm02_00306914 predicted 691
3 SASI_Mm02_00306915 predicted 502
4 SASI_Mm02_00306916 predicted 1222
5 SASI_Mm02_00306917 predicted 1182
6 SASI_Mm02_00306918 predicted 1215
7 SASI_Mm02_00306919 predicted 1277
8 SASI_Mm02_00306920 predicted 635
9 SASI_Mm02_00306921 predicted 406
10 SASI_Mm02_00306922 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306923 predicted 1209
2 SASI_Mm02_00306924 predicted 628
3 SASI_Mm02_00306925 predicted 445
4 SASI_Mm02_00306926 predicted 1164
5 SASI_Mm02_00306927 predicted 1118
6 SASI_Mm02_00306928 predicted 1162
7 SASI_Mm02_00306929 predicted 1212
8 SASI_Mm02_00306930 predicted 577
9 SASI_Mm02_00306931 predicted 343
10 SASI_Mm02_00306932 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320059 predicted 1274
2 SASI_Mm02_00320060 predicted 690
3 SASI_Mm02_00320061 predicted 500
4 SASI_Mm02_00320062 predicted 1230
5 SASI_Mm02_00320063 predicted 1177
6 SASI_Mm02_00320064 predicted 1219
7 SASI_Mm02_00320065 predicted 1275
8 SASI_Mm02_00320066 predicted 637
9 SASI_Mm01_00155169 predicted 408
10 SASI_Mm02_00320067 predicted 1182
11 SASI_Mm01_00155163 predicted 1073
12 SASI_Mm01_00155164 predicted 1107
13 SASI_Mm01_00155165 predicted 223
14 SASI_Mm01_00155166 predicted 216
15 SASI_Mm01_00155167 predicted 289
16 SASI_Mm01_00155168 predicted 1092
17 SASI_Mm01_00155170 predicted 1107
18 SASI_Mm01_00155171 predicted 1255
19 SASI_Mm01_00155172 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004762
VALIDATED
CYTH1 MISSION shRNA Bacterial Glycerol Stock
cytohesin 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-1055s1c1
Sequence:CCGGCCGACAATAAAGACCAAGTTACTCGAGTAACTTGGTCTTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-576s1c1
Sequence:CCGGCCAGCGATATTGTCAGTGCAACTCGAGTTGCACTGACAATATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004762.1-984s1c1
Sequence:CCGGCCCTTTAGAGAATCTGAGTATCTCGAGATACTCAGATTCTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-468s1c1
Sequence:CCGGGCATGAGTTCACTGATCTTAACTCGAGTTAAGATCAGTGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-766s1c1
Sequence:CCGGCGGAATCTCTATGAGAGCATACTCGAGTATGCTCTCATAGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-359s21c1
Sequence:GTACCGGCATTGCCCAGTTCTTATATAACTCGAGTTATATAAGAACTGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004762.2-3069s21c1
Sequence:CCGGGGGTCAGTATTAGTCTATTTACTCGAGTAAATAGACTAATACTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-718s21c1
Sequence:CCGGCCATGAACCGAGGCATCAATGCTCGAGCATTGATGCCTCGGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004762.2-568s21c1
Sequence:CCGGAGGCGTTTGCCCAGCGATATTCTCGAGAATATCGCTGGGCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-189s21c1
Sequence:CCGGGAGATAGCAGAAGTAGCTAATCTCGAGATTAGCTACTTCTGCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004762
VALIDATED
CYTH1 MISSION shRNA shRNA Plasmid DNA
cytohesin 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-1055s1c1
Sequence:CCGGCCGACAATAAAGACCAAGTTACTCGAGTAACTTGGTCTTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-576s1c1
Sequence:CCGGCCAGCGATATTGTCAGTGCAACTCGAGTTGCACTGACAATATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004762.1-984s1c1
Sequence:CCGGCCCTTTAGAGAATCTGAGTATCTCGAGATACTCAGATTCTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-468s1c1
Sequence:CCGGGCATGAGTTCACTGATCTTAACTCGAGTTAAGATCAGTGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-766s1c1
Sequence:CCGGCGGAATCTCTATGAGAGCATACTCGAGTATGCTCTCATAGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-359s21c1
Sequence:GTACCGGCATTGCCCAGTTCTTATATAACTCGAGTTATATAAGAACTGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004762.2-3069s21c1
Sequence:CCGGGGGTCAGTATTAGTCTATTTACTCGAGTAAATAGACTAATACTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-718s21c1
Sequence:CCGGCCATGAACCGAGGCATCAATGCTCGAGCATTGATGCCTCGGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004762.2-568s21c1
Sequence:CCGGAGGCGTTTGCCCAGCGATATTCTCGAGAATATCGCTGGGCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-189s21c1
Sequence:CCGGGAGATAGCAGAAGTAGCTAATCTCGAGATTAGCTACTTCTGCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004762
VALIDATED
CYTH1 MISSION shRNA Lentiviral Transduction Particles
cytohesin 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-1055s1c1
Sequence:CCGGCCGACAATAAAGACCAAGTTACTCGAGTAACTTGGTCTTTATTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-576s1c1
Sequence:CCGGCCAGCGATATTGTCAGTGCAACTCGAGTTGCACTGACAATATCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004762.1-984s1c1
Sequence:CCGGCCCTTTAGAGAATCTGAGTATCTCGAGATACTCAGATTCTCTAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-468s1c1
Sequence:CCGGGCATGAGTTCACTGATCTTAACTCGAGTTAAGATCAGTGAACTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004762.1-766s1c1
Sequence:CCGGCGGAATCTCTATGAGAGCATACTCGAGTATGCTCTCATAGAGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-359s21c1
Sequence:GTACCGGCATTGCCCAGTTCTTATATAACTCGAGTTATATAAGAACTGGGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004762.2-3069s21c1
Sequence:CCGGGGGTCAGTATTAGTCTATTTACTCGAGTAAATAGACTAATACTGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-718s21c1
Sequence:CCGGCCATGAACCGAGGCATCAATGCTCGAGCATTGATGCCTCGGTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004762.2-568s21c1
Sequence:CCGGAGGCGTTTGCCCAGCGATATTCTCGAGAATATCGCTGGGCAAACGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004762.2-189s21c1
Sequence:CCGGGAGATAGCAGAAGTAGCTAATCTCGAGATTAGCTACTTCTGCTATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011180
VALIDATED
CYTH1 MISSION shRNA Bacterial Glycerol Stock
cytohesin 1
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011180.2-1703s1c1
Sequence:CCGGCCACGCACTATAAAGATTTATCTCGAGATAAATCTTTATAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-149s1c1
Sequence:CCGGGCGTCAAGAACTGGAGAACATCTCGAGATGTTCTCCAGTTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-1073s1c1
Sequence:CCGGTGAGCTTTATATCCCTGACAACTCGAGTTGTCAGGGATATAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-1100s1c1
Sequence:CCGGCCAGGTGATTAAGGCCTGTAACTCGAGTTACAGGCCTTAATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-797s1c1
Sequence:CCGGCCGGAATCTCTATGAGAGCATCTCGAGATGCTCTCATAGAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-168s21c1
Sequence:GTACCGGGACTGCAGAAGAGCGTCAAGACTCGAGTCTTGACGCTCTTCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1669s21c1
Sequence:GTACCGGTGCTCCGAGAATGCCTGTAAGCTCGAGCTTACAGGCATTCTCGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-374s21c1
Sequence:CCGGTCCAGTTCTTAATCGAGAATGCTCGAGCATTCTCGATTAAGAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1727s21c1
Sequence:CCGGAGAGAAGCCACGCACTATAAACTCGAGTTTATAGTGCGTGGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1010s21c1
Sequence:CCGGTTGAATACACCACGGACAAAGCTCGAGCTTTGTCCGTGGTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-695s21c1
Sequence:CCGGTCCTGTCCTTCGCAATCATAACTCGAGTTATGATTGCGAAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1106s21c1
Sequence:CCGGAGCTTTATATCCCTGACAATACTCGAGTATTGTCAGGGATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-255s21c1
Sequence:GTACCGGAGCAGAAGTTGCTAATGAAATCTCGAGATTTCATTAGCAACTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-821s21c1
Sequence:GTACCGGAGCTGCTCCGGAATCTCTATGCTCGAGCATAGAGATTCCGGAGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011180
VALIDATED
CYTH1 MISSION shRNA shRNA Plasmid DNA
cytohesin 1
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011180.2-1703s1c1
Sequence:CCGGCCACGCACTATAAAGATTTATCTCGAGATAAATCTTTATAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-149s1c1
Sequence:CCGGGCGTCAAGAACTGGAGAACATCTCGAGATGTTCTCCAGTTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-1073s1c1
Sequence:CCGGTGAGCTTTATATCCCTGACAACTCGAGTTGTCAGGGATATAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-1100s1c1
Sequence:CCGGCCAGGTGATTAAGGCCTGTAACTCGAGTTACAGGCCTTAATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-797s1c1
Sequence:CCGGCCGGAATCTCTATGAGAGCATCTCGAGATGCTCTCATAGAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-168s21c1
Sequence:GTACCGGGACTGCAGAAGAGCGTCAAGACTCGAGTCTTGACGCTCTTCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1669s21c1
Sequence:GTACCGGTGCTCCGAGAATGCCTGTAAGCTCGAGCTTACAGGCATTCTCGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-374s21c1
Sequence:CCGGTCCAGTTCTTAATCGAGAATGCTCGAGCATTCTCGATTAAGAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1727s21c1
Sequence:CCGGAGAGAAGCCACGCACTATAAACTCGAGTTTATAGTGCGTGGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1010s21c1
Sequence:CCGGTTGAATACACCACGGACAAAGCTCGAGCTTTGTCCGTGGTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-695s21c1
Sequence:CCGGTCCTGTCCTTCGCAATCATAACTCGAGTTATGATTGCGAAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1106s21c1
Sequence:CCGGAGCTTTATATCCCTGACAATACTCGAGTATTGTCAGGGATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-255s21c1
Sequence:GTACCGGAGCAGAAGTTGCTAATGAAATCTCGAGATTTCATTAGCAACTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-821s21c1
Sequence:GTACCGGAGCTGCTCCGGAATCTCTATGCTCGAGCATAGAGATTCCGGAGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011180
VALIDATED
CYTH1 MISSION shRNA Lentiviral Transduction Particles
cytohesin 1
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110115    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011180.2-1703s1c1
Sequence:CCGGCCACGCACTATAAAGATTTATCTCGAGATAAATCTTTATAGTGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-149s1c1
Sequence:CCGGGCGTCAAGAACTGGAGAACATCTCGAGATGTTCTCCAGTTCTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-1073s1c1
Sequence:CCGGTGAGCTTTATATCCCTGACAACTCGAGTTGTCAGGGATATAAAGCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011180.2-1100s1c1
Sequence:CCGGCCAGGTGATTAAGGCCTGTAACTCGAGTTACAGGCCTTAATCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011180.2-797s1c1
Sequence:CCGGCCGGAATCTCTATGAGAGCATCTCGAGATGCTCTCATAGAGATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-168s21c1
Sequence:GTACCGGGACTGCAGAAGAGCGTCAAGACTCGAGTCTTGACGCTCTTCTGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1669s21c1
Sequence:GTACCGGTGCTCCGAGAATGCCTGTAAGCTCGAGCTTACAGGCATTCTCGGAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-374s21c1
Sequence:CCGGTCCAGTTCTTAATCGAGAATGCTCGAGCATTCTCGATTAAGAACTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328920    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011180.3-1727s21c1
Sequence:CCGGAGAGAAGCCACGCACTATAAACTCGAGTTTATAGTGCGTGGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1010s21c1
Sequence:CCGGTTGAATACACCACGGACAAAGCTCGAGCTTTGTCCGTGGTGTATTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-695s21c1
Sequence:CCGGTCCTGTCCTTCGCAATCATAACTCGAGTTATGATTGCGAAGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-1106s21c1
Sequence:CCGGAGCTTTATATCCCTGACAATACTCGAGTATTGTCAGGGATATAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-255s21c1
Sequence:GTACCGGAGCAGAAGTTGCTAATGAAATCTCGAGATTTCATTAGCAACTTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011180.3-821s21c1
Sequence:GTACCGGAGCTGCTCCGGAATCTCTATGCTCGAGCATAGAGATTCCGGAGCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks