EMAIL THIS PAGE TO A FRIEND

CYTH2

cytohesin 2

150 Gene Product Result for
Synonyms: ARNO CTS18 CTS18.1 PSCD2 PSCD2L SEC7L Sec7p-L Sec7p-like
UniProtKB ID: Q99418, A8K8P0, Q8IXY9, Q92958
Gene ID:
Human(9266) Summary: The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. The encoded protein exhibits GEP activity in vitro with ARF1, ARF3, and ARF6 and is 83% homologous to CYTH1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(19158) cytohesin 2
Rat(116692) cytohesin 2
dog(476423) cytohesin 2
cow(768035) cytohesin 2
Horse(100053821) cytohesin 2
sheep(100216436) cytohesin 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017457 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004228 Rosetta Predictions human pricing
NM_017457 Rosetta Predictions human pricing
NM_053911 Rosetta Predictions rat pricing
NM_001112701 Rosetta Predictions mouse pricing
NM_011181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004228 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027266 predicted 1308
2 SASI_Hs01_00027267 predicted 334
3 SASI_Hs01_00027268 predicted 696
4 SASI_Hs01_00027269 predicted 319
5 SASI_Hs02_00337145 predicted 583
6 SASI_Hs01_00027270 predicted 303
7 SASI_Hs01_00027271 predicted 303
8 SASI_Hs01_00027272 predicted 651
9 SASI_Hs01_00027273 predicted 1288
10 SASI_Hs01_00027274 predicted 1305
11 SASI_Hs01_00027275 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032469 predicted 1308
2 SASI_Hs01_00032470 predicted 331
3 SASI_Hs01_00032471 predicted 698
4 SASI_Hs01_00032472 predicted 322
5 SASI_Hs02_00350084 predicted 582
6 SASI_Hs01_00032473 predicted 298
7 SASI_Hs01_00032474 predicted 303
8 SASI_Hs01_00032475 predicted 656
9 SASI_Hs01_00032476 predicted 1292
10 SASI_Hs01_00032477 predicted 1307
11 SASI_Hs01_00032478 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039892 predicted 1142
2 SASI_Rn01_00039893 predicted 1153
3 SASI_Rn01_00039894 predicted 419
4 SASI_Rn01_00039895 predicted 1152
5 SASI_Rn01_00039896 predicted 689
6 SASI_Rn02_00266845 predicted 461
7 SASI_Rn01_00039897 predicted 234
8 SASI_Rn01_00039898 predicted 1110
9 SASI_Rn01_00039899 predicted 770
10 SASI_Rn01_00039900 predicted 878
11 SASI_Rn01_00039901 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306933 predicted 438
2 SASI_Mm02_00306934 predicted 1729
3 SASI_Mm02_00306935 predicted 1332
4 SASI_Mm02_00306936 predicted 1714
5 SASI_Mm02_00306937 predicted 1355
6 SASI_Mm02_00306938 predicted 474
7 SASI_Mm02_00306939 predicted 1717
8 SASI_Mm02_00306940 predicted 1276
9 SASI_Mm02_00306941 predicted 768
10 SASI_Mm02_00306942 predicted 1729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196655 predicted 433
2 SASI_Mm02_00320068 predicted 1734
3 SASI_Mm01_00196658 predicted 1340
4 SASI_Mm02_00320069 predicted 1713
5 SASI_Mm01_00196661 predicted 1359
6 SASI_Mm01_00196662 predicted 481
7 SASI_Mm02_00320070 predicted 1717
8 SASI_Mm01_00196663 predicted 1280
9 SASI_Mm01_00196664 predicted 764
10 SASI_Mm02_00320071 predicted 1734
11 SASI_Mm01_00196656 predicted 1134
12 SASI_Mm01_00196657 predicted 1138
13 SASI_Mm01_00196659 predicted 1012
14 SASI_Mm01_00196660 predicted 1145
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011181
VALIDATED
CYTH2 MISSION shRNA Bacterial Glycerol Stock
cytohesin 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-700s21c1
Sequence:GTACCGGTTGCCCAGAGATACTGCTTATCTCGAGATAAGCAGTATCTCTGGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-468s21c1
Sequence:GTACCGGCAGAACACGCCTGAGGAAATTCTCGAGAATTTCCTCAGGCGTGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-912s21c1
Sequence:GTACCGGATCCGGAACGAGCCCTTCAAACTCGAGTTTGAAGGGCTCGTTCCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-314s21c1
Sequence:GTACCGGAGAGCTAAGTGAAGCTATGAGCTCGAGCTCATAGCTTCACTTAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-761s21c1
Sequence:GTACCGGGTTGTCCTTTGCCGTGATCATCTCGAGATGATCACGGCAAAGGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1249s21c1
Sequence:GTACCGGACCACATGGTGTACCGAATCTCTCGAGAGATTCGGTACACCATGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1171s21c1
Sequence:GTACCGGAGCTTTACATTCCCAACAATACTCGAGTATTGTTGGGAATGTAAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1256s1c1
Sequence:CCGGGAGAAAGATGAGTGGATCAAACTCGAGTTTGATCCACTCATCTTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1322s1c1
Sequence:CCGGGCAGCAAGAAAGAAGCGAATTCTCGAGAATTCGCTTCTTTCTTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011181.2-1139s1c1
Sequence:CCGGGAGCTTTACATTCCCAACAATCTCGAGATTGTTGGGAATGTAAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-280s1c1
Sequence:CCGGAGAAGAGCTAAGTGAAGCTATCTCGAGATAGCTTCACTTAGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1488s1c1
Sequence:CCGGCCTGACTCCTTATTTGTAATTCTCGAGAATTACAAATAAGGAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011181
VALIDATED
CYTH2 MISSION shRNA shRNA Plasmid DNA
cytohesin 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-700s21c1
Sequence:GTACCGGTTGCCCAGAGATACTGCTTATCTCGAGATAAGCAGTATCTCTGGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-468s21c1
Sequence:GTACCGGCAGAACACGCCTGAGGAAATTCTCGAGAATTTCCTCAGGCGTGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-912s21c1
Sequence:GTACCGGATCCGGAACGAGCCCTTCAAACTCGAGTTTGAAGGGCTCGTTCCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-314s21c1
Sequence:GTACCGGAGAGCTAAGTGAAGCTATGAGCTCGAGCTCATAGCTTCACTTAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-761s21c1
Sequence:GTACCGGGTTGTCCTTTGCCGTGATCATCTCGAGATGATCACGGCAAAGGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1249s21c1
Sequence:GTACCGGACCACATGGTGTACCGAATCTCTCGAGAGATTCGGTACACCATGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1171s21c1
Sequence:GTACCGGAGCTTTACATTCCCAACAATACTCGAGTATTGTTGGGAATGTAAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1256s1c1
Sequence:CCGGGAGAAAGATGAGTGGATCAAACTCGAGTTTGATCCACTCATCTTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1322s1c1
Sequence:CCGGGCAGCAAGAAAGAAGCGAATTCTCGAGAATTCGCTTCTTTCTTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011181.2-1139s1c1
Sequence:CCGGGAGCTTTACATTCCCAACAATCTCGAGATTGTTGGGAATGTAAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-280s1c1
Sequence:CCGGAGAAGAGCTAAGTGAAGCTATCTCGAGATAGCTTCACTTAGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1488s1c1
Sequence:CCGGCCTGACTCCTTATTTGTAATTCTCGAGAATTACAAATAAGGAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011181
VALIDATED
CYTH2 MISSION shRNA Lentiviral Transduction Particles
cytohesin 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-700s21c1
Sequence:GTACCGGTTGCCCAGAGATACTGCTTATCTCGAGATAAGCAGTATCTCTGGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-468s21c1
Sequence:GTACCGGCAGAACACGCCTGAGGAAATTCTCGAGAATTTCCTCAGGCGTGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-912s21c1
Sequence:GTACCGGATCCGGAACGAGCCCTTCAAACTCGAGTTTGAAGGGCTCGTTCCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-314s21c1
Sequence:GTACCGGAGAGCTAAGTGAAGCTATGAGCTCGAGCTCATAGCTTCACTTAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380282    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-761s21c1
Sequence:GTACCGGGTTGTCCTTTGCCGTGATCATCTCGAGATGATCACGGCAAAGGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1249s21c1
Sequence:GTACCGGACCACATGGTGTACCGAATCTCTCGAGAGATTCGGTACACCATGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011181.3-1171s21c1
Sequence:GTACCGGAGCTTTACATTCCCAACAATACTCGAGTATTGTTGGGAATGTAAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1256s1c1
Sequence:CCGGGAGAAAGATGAGTGGATCAAACTCGAGTTTGATCCACTCATCTTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1322s1c1
Sequence:CCGGGCAGCAAGAAAGAAGCGAATTCTCGAGAATTCGCTTCTTTCTTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011181.2-1139s1c1
Sequence:CCGGGAGCTTTACATTCCCAACAATCTCGAGATTGTTGGGAATGTAAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-280s1c1
Sequence:CCGGAGAAGAGCTAAGTGAAGCTATCTCGAGATAGCTTCACTTAGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110095    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011181.2-1488s1c1
Sequence:CCGGCCTGACTCCTTATTTGTAATTCTCGAGAATTACAAATAAGGAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017457
VALIDATED
CYTH2 MISSION shRNA Bacterial Glycerol Stock
cytohesin 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1866s21c1
Sequence:GTACCGGGGGAGTCTGGAGTTGGAATTGCTCGAGCAATTCCAACTCCAGACTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.3-1372s21c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1307s21c1
Sequence:CCGGCAGCGAGAAAGAAGCGGATTTCTCGAGAAATCCGCTTCTTTCTCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1111s21c1
Sequence:CCGGCCGAACTGCTTTGAACTTTACCTCGAGGTAAAGTTCAAAGCAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-853s21c1
Sequence:CCGGCTGTACGACAGCATCCGAAATCTCGAGATTTCGGATGCTGTCGTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1841s21c1
Sequence:GTACCGGAGTAAAGGGAGAAGGTTAATACTCGAGTATTAACCTTCTCCCTTTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017457.3-1372s1c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-394s1c1
Sequence:CCGGCAGTTCTTGGTGGAGAATGAACTCGAGTTCATTCTCCACCAAGAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1105s1c1
Sequence:CCGGCGGAAACCGAACTGCTTTGAACTCGAGTTCAAAGCAGTTCGGTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1320s1c1
Sequence:CCGGGCGGATTTCAGTCAAGAAGAACTCGAGTTCTTCTTGACTGAAATCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017457
VALIDATED
CYTH2 MISSION shRNA shRNA Plasmid DNA
cytohesin 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1866s21c1
Sequence:GTACCGGGGGAGTCTGGAGTTGGAATTGCTCGAGCAATTCCAACTCCAGACTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.3-1372s21c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1307s21c1
Sequence:CCGGCAGCGAGAAAGAAGCGGATTTCTCGAGAAATCCGCTTCTTTCTCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1111s21c1
Sequence:CCGGCCGAACTGCTTTGAACTTTACCTCGAGGTAAAGTTCAAAGCAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-853s21c1
Sequence:CCGGCTGTACGACAGCATCCGAAATCTCGAGATTTCGGATGCTGTCGTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1841s21c1
Sequence:GTACCGGAGTAAAGGGAGAAGGTTAATACTCGAGTATTAACCTTCTCCCTTTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017457.3-1372s1c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-394s1c1
Sequence:CCGGCAGTTCTTGGTGGAGAATGAACTCGAGTTCATTCTCCACCAAGAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1105s1c1
Sequence:CCGGCGGAAACCGAACTGCTTTGAACTCGAGTTCAAAGCAGTTCGGTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1320s1c1
Sequence:CCGGGCGGATTTCAGTCAAGAAGAACTCGAGTTCTTCTTGACTGAAATCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017457
VALIDATED
CYTH2 MISSION shRNA Lentiviral Transduction Particles
cytohesin 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381561    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1866s21c1
Sequence:GTACCGGGGGAGTCTGGAGTTGGAATTGCTCGAGCAATTCCAACTCCAGACTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233536    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.3-1372s21c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1307s21c1
Sequence:CCGGCAGCGAGAAAGAAGCGGATTTCTCGAGAAATCCGCTTCTTTCTCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-1111s21c1
Sequence:CCGGCCGAACTGCTTTGAACTTTACCTCGAGGTAAAGTTCAAAGCAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017457.3-853s21c1
Sequence:CCGGCTGTACGACAGCATCCGAAATCTCGAGATTTCGGATGCTGTCGTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017457.4-1841s21c1
Sequence:GTACCGGAGTAAAGGGAGAAGGTTAATACTCGAGTATTAACCTTCTCCCTTTACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017457.3-1372s1c1
Sequence:CCGGTCCATTATTTATTACGGAGCTCTCGAGAGCTCCGTAATAAATAATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-394s1c1
Sequence:CCGGCAGTTCTTGGTGGAGAATGAACTCGAGTTCATTCTCCACCAAGAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1105s1c1
Sequence:CCGGCGGAAACCGAACTGCTTTGAACTCGAGTTCAAAGCAGTTCGGTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_017457.3-1320s1c1
Sequence:CCGGGCGGATTTCAGTCAAGAAGAACTCGAGTTCTTCTTGACTGAAATCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)