EMAIL THIS PAGE TO A FRIEND

CYTH3

cytohesin 3

88 Gene Product Result for
Synonyms: ARNO3 GRP1 PSCD3
UniProtKB ID: O43739, A4D2N8
Gene ID:
Human(9265) Summary: This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Mouse(19159) cytohesin 3
Rat(116693) cytohesin 3
sheep(101105381) cytohesin 3
Zebrafish(100002190) cytohesin 3
chicken(416626) cytohesin 3
dog(609100) cytohesin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004227 Rosetta Predictions human pricing
NM_053912 Rosetta Predictions rat pricing
NM_011182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106980 predicted 1276
2 SASI_Hs01_00106981 predicted 977
3 SASI_Hs01_00106982 predicted 220
4 SASI_Hs01_00106983 predicted 827
5 SASI_Hs01_00106984 predicted 1085
6 SASI_Hs01_00106986 predicted 1256
7 SASI_Hs01_00106987 predicted 732
8 SASI_Hs01_00106988 predicted 542
9 SASI_Hs01_00106989 predicted 492
10 SASI_Hs02_00337144 predicted 425
11 SASI_Hs01_00106985 predicted 351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081255 predicted 677
2 SASI_Rn01_00081256 predicted 1115
3 SASI_Rn01_00081257 predicted 228
4 SASI_Rn01_00081258 predicted 1305
5 SASI_Rn02_00266846 predicted 228
6 SASI_Rn02_00266847 predicted 1119
7 SASI_Rn02_00266848 predicted 536
8 SASI_Rn01_00081262 predicted 824
9 SASI_Rn01_00081263 predicted 1176
10 SASI_Rn01_00081264 predicted 242
11 SASI_Rn01_00081259 predicted 684
12 SASI_Rn01_00081260 predicted 212
13 SASI_Rn01_00081261 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053062 predicted 1289
2 SASI_Mm01_00053063 predicted 210
3 SASI_Mm01_00053064 predicted 583
4 SASI_Mm01_00053065 predicted 1100
5 SASI_Mm01_00053066 predicted 1108
6 SASI_Mm01_00053067 predicted 1253
7 SASI_Mm01_00053068 predicted 1281
8 SASI_Mm01_00053069 predicted 656
9 SASI_Mm01_00053070 predicted 258
10 SASI_Mm01_00053071 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004227
VALIDATED
CYTH3 MISSION shRNA Bacterial Glycerol Stock
cytohesin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3977s1c1
Sequence:CCGGCCTGGTTCATATTTGAGTTTACTCGAGTAAACTCAAATATGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-210s1c1
Sequence:CCGGGATGACATTGAGAGGCTGAAACTCGAGTTTCAGCCTCTCAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-141s1c1
Sequence:CCGGCCTGAAGACCTCTCATTAGAACTCGAGTTCTAATGAGAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3976s1c1
Sequence:CCGGCCCTGGTTCATATTTGAGTTTCTCGAGAAACTCAAATATGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-463s21c1
Sequence:CCGGTGGGTGAAAGGGATGAATTTACTCGAGTAAATTCATCCCTTTCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-247s21c1
Sequence:CCGGTGATGACAGAGATCGACAATCCTCGAGGATTGTCGATCTCTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-433s21c1
Sequence:CCGGGCCTAAATAAGACCGTCATTGCTCGAGCAATGACGGTCTTATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004227
VALIDATED
CYTH3 MISSION shRNA shRNA Plasmid DNA
cytohesin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3977s1c1
Sequence:CCGGCCTGGTTCATATTTGAGTTTACTCGAGTAAACTCAAATATGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-210s1c1
Sequence:CCGGGATGACATTGAGAGGCTGAAACTCGAGTTTCAGCCTCTCAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-141s1c1
Sequence:CCGGCCTGAAGACCTCTCATTAGAACTCGAGTTCTAATGAGAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3976s1c1
Sequence:CCGGCCCTGGTTCATATTTGAGTTTCTCGAGAAACTCAAATATGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-463s21c1
Sequence:CCGGTGGGTGAAAGGGATGAATTTACTCGAGTAAATTCATCCCTTTCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-247s21c1
Sequence:CCGGTGATGACAGAGATCGACAATCCTCGAGGATTGTCGATCTCTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-433s21c1
Sequence:CCGGGCCTAAATAAGACCGTCATTGCTCGAGCAATGACGGTCTTATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004227
VALIDATED
CYTH3 MISSION shRNA Lentiviral Transduction Particles
cytohesin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183827    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3977s1c1
Sequence:CCGGCCTGGTTCATATTTGAGTTTACTCGAGTAAACTCAAATATGAACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-210s1c1
Sequence:CCGGGATGACATTGAGAGGCTGAAACTCGAGTTTCAGCCTCTCAATGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-141s1c1
Sequence:CCGGCCTGAAGACCTCTCATTAGAACTCGAGTTCTAATGAGAGGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_004227.3-3976s1c1
Sequence:CCGGCCCTGGTTCATATTTGAGTTTCTCGAGAAACTCAAATATGAACCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-463s21c1
Sequence:CCGGTGGGTGAAAGGGATGAATTTACTCGAGTAAATTCATCCCTTTCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-247s21c1
Sequence:CCGGTGATGACAGAGATCGACAATCCTCGAGGATTGTCGATCTCTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004227.3-433s21c1
Sequence:CCGGGCCTAAATAAGACCGTCATTGCTCGAGCAATGACGGTCTTATTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011182
VALIDATED
CYTH3 MISSION shRNA Bacterial Glycerol Stock
cytohesin 3
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-256s1c1
Sequence:CCGGCGGAGATTGACAACCTGACTTCTCGAGAAGTCAGGTTGTCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-1228s1c1
Sequence:CCGGCCATCAAAGCAAGCATCAGTACTCGAGTACTGATGCTTGCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011182.2-2186s1c1
Sequence:CCGGGCTGTTTCAAACTTGGGTTAACTCGAGTTAACCCAAGTTTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-144s1c1
Sequence:CCGGCCTGAAGACCTGTCATTAGAACTCGAGTTCTAATGACAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-153s1c1
Sequence:CCGGCTGTCATTAGAAGAGCGAGAACTCGAGTTCTCGCTCTTCTAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-1379s21c1
Sequence:GTACCGGGCCAATAAGAAATAGGTAAATCTCGAGATTTACCTATTTCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-330s21c1
Sequence:GTACCGGCAGAAGTGATGACGGAGATTGCTCGAGCAATCTCCGTCATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011182
VALIDATED
CYTH3 MISSION shRNA shRNA Plasmid DNA
cytohesin 3
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-256s1c1
Sequence:CCGGCGGAGATTGACAACCTGACTTCTCGAGAAGTCAGGTTGTCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-1228s1c1
Sequence:CCGGCCATCAAAGCAAGCATCAGTACTCGAGTACTGATGCTTGCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011182.2-2186s1c1
Sequence:CCGGGCTGTTTCAAACTTGGGTTAACTCGAGTTAACCCAAGTTTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-144s1c1
Sequence:CCGGCCTGAAGACCTGTCATTAGAACTCGAGTTCTAATGACAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-153s1c1
Sequence:CCGGCTGTCATTAGAAGAGCGAGAACTCGAGTTCTCGCTCTTCTAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-1379s21c1
Sequence:GTACCGGGCCAATAAGAAATAGGTAAATCTCGAGATTTACCTATTTCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-330s21c1
Sequence:GTACCGGCAGAAGTGATGACGGAGATTGCTCGAGCAATCTCCGTCATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011182
VALIDATED
CYTH3 MISSION shRNA Lentiviral Transduction Particles
cytohesin 3
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-256s1c1
Sequence:CCGGCGGAGATTGACAACCTGACTTCTCGAGAAGTCAGGTTGTCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-1228s1c1
Sequence:CCGGCCATCAAAGCAAGCATCAGTACTCGAGTACTGATGCTTGCTTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011182.2-2186s1c1
Sequence:CCGGGCTGTTTCAAACTTGGGTTAACTCGAGTTAACCCAAGTTTGAAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011182.2-144s1c1
Sequence:CCGGCCTGAAGACCTGTCATTAGAACTCGAGTTCTAATGACAGGTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011182.2-153s1c1
Sequence:CCGGCTGTCATTAGAAGAGCGAGAACTCGAGTTCTCGCTCTTCTAATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382324    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-1379s21c1
Sequence:GTACCGGGCCAATAAGAAATAGGTAAATCTCGAGATTTACCTATTTCTTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011182.4-330s21c1
Sequence:GTACCGGCAGAAGTGATGACGGAGATTGCTCGAGCAATCTCCGTCATCACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks