EMAIL THIS PAGE TO A FRIEND

CYTH4

cytohesin 4

53 Gene Product Result for
Synonyms: CYT4 DJ63G5.1 PSCD4
UniProtKB ID: Q9UIA0, Q5R3F9, Q9UGT6
Gene ID:
Human(27128) Summary: The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. The encoded protein exhibits GEP activity in vitro with both ARF1 and ARF5 but is inactive with ARF6. The structures of this gene and CYTH1 are very similar. [provided by RefSeq, Aug 2008]
Mouse(72318) cytohesin 4
Rat(500906) cytohesin 4
chicken(418043) cytohesin 4
cow(517887) cytohesin 4
Horse(100069735) cytohesin 4
dog(481270) cytohesin 4
sheep(101103309) cytohesin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028195 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028195 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028195 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013385 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU032691 MISSION® esiRNA esiRNA targeting mouse Cyth4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013385 Rosetta Predictions human pricing
NM_001130577 Rosetta Predictions rat pricing
NM_028195 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070373 predicted 1162
2 SASI_Hs01_00070374 predicted 315
3 SASI_Hs01_00070376 predicted 887
4 SASI_Hs01_00070377 predicted 728
5 SASI_Hs01_00070378 predicted 259
6 SASI_Hs01_00070379 predicted 245
7 SASI_Hs01_00070380 predicted 1285
8 SASI_Hs01_00070382 predicted 879
9 SASI_Hs02_00344737 predicted 464
10 SASI_Hs02_00344738 predicted 377
11 SASI_Hs01_00070375 predicted 755
12 SASI_Hs01_00070381 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130577 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255939 predicted 1535
2 SASI_Rn02_00255940 predicted 1347
3 SASI_Rn02_00255941 predicted 661
4 SASI_Rn02_00255942 predicted 1642
5 SASI_Rn02_00255943 predicted 1154
6 SASI_Rn02_00255944 predicted 242
7 SASI_Rn02_00255945 predicted 1626
8 SASI_Rn02_00255946 predicted 770
9 SASI_Rn02_00255947 predicted 712
10 SASI_Rn02_00255948 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028195 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054656 predicted 790
2 SASI_Mm01_00054657 predicted 205
3 SASI_Mm01_00054658 predicted 283
4 SASI_Mm01_00054659 predicted 375
5 SASI_Mm01_00054660 predicted 1003
6 SASI_Mm01_00054661 predicted 264
7 SASI_Mm01_00054662 predicted 373
8 SASI_Mm01_00054663 predicted 849
9 SASI_Mm01_00054664 predicted 854
10 SASI_Mm01_00054665 predicted 1013
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028195
CYTH4 MISSION shRNA Bacterial Glycerol Stock
cytohesin 4
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-786s21c1
Sequence:GTACCGGAGCGCTTTGTGACCATGAATCCTCGAGGATTCATGGTCACAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-205s21c1
Sequence:GTACCGGGGAGCTACAGCAGATCAAATGCTCGAGCATTTGATCTGCTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-714s21c1
Sequence:GTACCGGTGCTGTCCTTCTCCGTCATCACTCGAGTGATGACGGAGAAGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-840s21c1
Sequence:GTACCGGAGCAGCTACGGAACCTGTTTGCTCGAGCAAACAGGTTCCGTAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1659s21c1
Sequence:GTACCGGTCCCTTACATTGGGAAGTATCCTCGAGGATACTTCCCAATGTAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-274s21c1
Sequence:GTACCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1831s21c1
Sequence:GTACCGGGGGAGATCAGGTGACTGAATGCTCGAGCATTCAGTCACCTGATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-1026s21c1
Sequence:GTACCGGTTGAGTTCACCACTGACAAAGCTCGAGCTTTGTCAGTGGTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-909s21c1
Sequence:GTACCGGACCTCACTCACACCTTCTTTACTCGAGTAAAGAAGGTGTGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-218s1c1
Sequence:CCGGGCCCAAATCGACTGCTTTGAACTCGAGTTCAAAGCAGTCGATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-286s1c1
Sequence:CCGGCGGGAGAAAGAAATTCAACATCTCGAGATGTTGAATTTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-1129s1c1
Sequence:CCGGCAAACATGAATCTTACCGCATCTCGAGATGCGGTAAGATTCATGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-841s1c1
Sequence:CCGGCCTCACTCACACCTTCTTTAACTCGAGTTAAAGAAGGTGTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028195
CYTH4 MISSION shRNA shRNA Plasmid DNA
cytohesin 4
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-786s21c1
Sequence:GTACCGGAGCGCTTTGTGACCATGAATCCTCGAGGATTCATGGTCACAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-205s21c1
Sequence:GTACCGGGGAGCTACAGCAGATCAAATGCTCGAGCATTTGATCTGCTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-714s21c1
Sequence:GTACCGGTGCTGTCCTTCTCCGTCATCACTCGAGTGATGACGGAGAAGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-840s21c1
Sequence:GTACCGGAGCAGCTACGGAACCTGTTTGCTCGAGCAAACAGGTTCCGTAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1659s21c1
Sequence:GTACCGGTCCCTTACATTGGGAAGTATCCTCGAGGATACTTCCCAATGTAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-274s21c1
Sequence:GTACCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1831s21c1
Sequence:GTACCGGGGGAGATCAGGTGACTGAATGCTCGAGCATTCAGTCACCTGATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-1026s21c1
Sequence:GTACCGGTTGAGTTCACCACTGACAAAGCTCGAGCTTTGTCAGTGGTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-909s21c1
Sequence:GTACCGGACCTCACTCACACCTTCTTTACTCGAGTAAAGAAGGTGTGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-218s1c1
Sequence:CCGGGCCCAAATCGACTGCTTTGAACTCGAGTTCAAAGCAGTCGATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-286s1c1
Sequence:CCGGCGGGAGAAAGAAATTCAACATCTCGAGATGTTGAATTTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-1129s1c1
Sequence:CCGGCAAACATGAATCTTACCGCATCTCGAGATGCGGTAAGATTCATGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-841s1c1
Sequence:CCGGCCTCACTCACACCTTCTTTAACTCGAGTTAAAGAAGGTGTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028195
CYTH4 MISSION shRNA Lentiviral Transduction Particles
cytohesin 4
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-786s21c1
Sequence:GTACCGGAGCGCTTTGTGACCATGAATCCTCGAGGATTCATGGTCACAAAGCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-205s21c1
Sequence:GTACCGGGGAGCTACAGCAGATCAAATGCTCGAGCATTTGATCTGCTGTAGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-714s21c1
Sequence:GTACCGGTGCTGTCCTTCTCCGTCATCACTCGAGTGATGACGGAGAAGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-840s21c1
Sequence:GTACCGGAGCAGCTACGGAACCTGTTTGCTCGAGCAAACAGGTTCCGTAGCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379779    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1659s21c1
Sequence:GTACCGGTCCCTTACATTGGGAAGTATCCTCGAGGATACTTCCCAATGTAAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-274s21c1
Sequence:GTACCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028195.3-1831s21c1
Sequence:GTACCGGGGGAGATCAGGTGACTGAATGCTCGAGCATTCAGTCACCTGATCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-1026s21c1
Sequence:GTACCGGTTGAGTTCACCACTGACAAAGCTCGAGCTTTGTCAGTGGTGAACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028195.3-909s21c1
Sequence:GTACCGGACCTCACTCACACCTTCTTTACTCGAGTAAAGAAGGTGTGAGTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-218s1c1
Sequence:CCGGGCCCAAATCGACTGCTTTGAACTCGAGTTCAAAGCAGTCGATTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-286s1c1
Sequence:CCGGCGGGAGAAAGAAATTCAACATCTCGAGATGTTGAATTTCTTTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-1129s1c1
Sequence:CCGGCAAACATGAATCTTACCGCATCTCGAGATGCGGTAAGATTCATGTTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028195.2-841s1c1
Sequence:CCGGCCTCACTCACACCTTCTTTAACTCGAGTTAAAGAAGGTGTGAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013385
CYTH4 MISSION shRNA Bacterial Glycerol Stock
cytohesin 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-236s21c1
Sequence:CCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013385.3-2192s21c1
Sequence:CCGGCAAGCAGGATGGGTGCTATATCTCGAGATATAGCACCCATCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-343s21c1
Sequence:CCGGCCGCCAAGGGTATCCAGTATTCTCGAGAATACTGGATACCCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-403s21c1
Sequence:CCGGTTGCACGGTTCCTGTATAAAGCTCGAGCTTTATACAGGAACCGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-1468s1c1
Sequence:CCGGGCCACAGACATCATTGCTGTTCTCGAGAACAGCAATGATGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-2288s1c1
Sequence:CCGGGAAGCCAAGAAGGGAGAGTTTCTCGAGAAACTCTCCCTTCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013385
CYTH4 MISSION shRNA shRNA Plasmid DNA
cytohesin 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-236s21c1
Sequence:CCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013385.3-2192s21c1
Sequence:CCGGCAAGCAGGATGGGTGCTATATCTCGAGATATAGCACCCATCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-343s21c1
Sequence:CCGGCCGCCAAGGGTATCCAGTATTCTCGAGAATACTGGATACCCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-403s21c1
Sequence:CCGGTTGCACGGTTCCTGTATAAAGCTCGAGCTTTATACAGGAACCGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-1468s1c1
Sequence:CCGGGCCACAGACATCATTGCTGTTCTCGAGAACAGCAATGATGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-2288s1c1
Sequence:CCGGGAAGCCAAGAAGGGAGAGTTTCTCGAGAAACTCTCCCTTCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013385
CYTH4 MISSION shRNA Lentiviral Transduction Particles
cytohesin 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-236s21c1
Sequence:CCGGTGCAGATGTGTTTGCCCAAATCTCGAGATTTGGGCAAACACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013385.3-2192s21c1
Sequence:CCGGCAAGCAGGATGGGTGCTATATCTCGAGATATAGCACCCATCCTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-343s21c1
Sequence:CCGGCCGCCAAGGGTATCCAGTATTCTCGAGAATACTGGATACCCTTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013385.3-403s21c1
Sequence:CCGGTTGCACGGTTCCTGTATAAAGCTCGAGCTTTATACAGGAACCGTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-1468s1c1
Sequence:CCGGGCCACAGACATCATTGCTGTTCTCGAGAACAGCAATGATGTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180673    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013385.2-2288s1c1
Sequence:CCGGGAAGCCAAGAAGGGAGAGTTTCTCGAGAAACTCTCCCTTCTTGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks