EMAIL THIS PAGE TO A FRIEND

CYTIP

cytohesin 1 interacting protein

92 Gene Product Result for
Synonyms: B3-1 CASP CYBR CYTHIP HE PSCDBP
UniProtKB ID: O60759, Q15630, Q8NE32
Gene ID:
Human(9595) Summary: The protein encoded by this gene contains 2 leucine zipper domains and a putative C-terminal nuclear targeting signal, but does not have any hydrophobic regions. This protein is expressed weakly in resting NK and T cells. The encoded protein modulates the activation of ARF genes by CYTH1. This protein interacts with CYTH1 and SNX27 proteins and may act to sequester CYTH1 protein in the cytoplasm.[provided by RefSeq, Aug 2008]
Mouse(227929) cytohesin 1 interacting protein
Rat(311047) cytohesin 1 interacting protein
chicken(429052) cytohesin 1 interacting protein
cow(540450) cytohesin 1 interacting protein
domestic cat(101090790) cytohesin 1 interacting protein
dog(488360) cytohesin 1 interacting protein
naked mole-rat(101713514) cytohesin 1 interacting protein
domestic guinea pig(100720926) cytohesin 1 interacting protein
sheep(101113467) cytohesin 1 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139200 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139200 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139200 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004288 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004288 Rosetta Predictions human pricing
NM_001012086 Rosetta Predictions rat pricing
XM_575137 Rosetta Predictions rat pricing
NM_139200 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337287 predicted 241
2 SASI_Hs01_00068365 predicted 555
3 SASI_Hs01_00068366 predicted 540
4 SASI_Hs01_00068367 predicted 244
5 SASI_Hs01_00068369 predicted 383
6 SASI_Hs01_00068370 predicted 230
7 SASI_Hs01_00068371 predicted 1163
8 SASI_Hs01_00068372 predicted 529
9 SASI_Hs01_00068373 predicted 716
10 SASI_Hs01_00068374 predicted 1145
11 SASI_Hs01_00068368 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076389 predicted 311
2 SASI_Rn01_00076390 predicted 514
3 SASI_Rn01_00076391 predicted 292
4 SASI_Rn01_00076392 predicted 227
5 SASI_Rn01_00076393 predicted 952
6 SASI_Rn01_00076394 predicted 505
7 SASI_Rn01_00076395 predicted 911
8 SASI_Rn01_00076396 predicted 962
9 SASI_Rn01_00076397 predicted 289
10 SASI_Rn01_00076398 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00147084 predicted 317
2 SASI_Rn01_00147085 predicted 524
3 SASI_Rn01_00147086 predicted 304
4 SASI_Rn01_00147087 predicted 236
5 SASI_Rn01_00147088 predicted 951
6 SASI_Rn01_00147089 predicted 510
7 SASI_Rn01_00147090 predicted 917
8 SASI_Rn01_00147091 predicted 967
9 SASI_Rn01_00147092 predicted 302
10 SASI_Rn01_00147093 predicted 372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139200 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339919 predicted 250
2 SASI_Mm02_00339920 predicted 551
3 SASI_Mm01_00150988 predicted 549
4 SASI_Mm01_00150985 predicted 1238
5 SASI_Mm01_00150986 predicted 543
6 SASI_Mm01_00150987 predicted 528
7 SASI_Mm01_00150989 predicted 308
8 SASI_Mm01_00150990 predicted 445
9 SASI_Mm01_00150992 predicted 987
10 SASI_Mm01_00150993 predicted 931
11 SASI_Mm01_00150991 predicted 496
12 SASI_Mm01_00150994 predicted 338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139200
CYTIP MISSION shRNA Bacterial Glycerol Stock
cytohesin 1 interacting protein
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-327s1c1
Sequence:CCGGGTGTGCACTATGATCTGCAAACTCGAGTTTGCAGATCATAGTGCACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-196s1c1
Sequence:CCGGGATCAAGCTCTTTGGGTGATTCTCGAGAATCACCCAAAGAGCTTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-962s1c1
Sequence:CCGGGAGCAATTACTCAAGCGTGTTCTCGAGAACACGCTTGAGTAATTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1963s1c1
Sequence:CCGGCCTTGTTAGCTGTGCTTGTATCTCGAGATACAAGCACAGCTAACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1212s1c1
Sequence:CCGGGCAGTGACCTTTAAGTTCTTACTCGAGTAAGAACTTAAAGGTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-665s1c1
Sequence:CCGGCGAGTCGTCCTTGTTTGGAAACTCGAGTTTCCAAACAAGGACGACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-113s1c1
Sequence:CCGGGATGGAAGACAACCGAAGGATCTCGAGATCCTTCGGTTGTCTTCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1920s1c1
Sequence:CCGGCCTCATTAAACATTCCACATACTCGAGTATGTGGAATGTTTAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139200
CYTIP MISSION shRNA shRNA Plasmid DNA
cytohesin 1 interacting protein
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-327s1c1
Sequence:CCGGGTGTGCACTATGATCTGCAAACTCGAGTTTGCAGATCATAGTGCACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-196s1c1
Sequence:CCGGGATCAAGCTCTTTGGGTGATTCTCGAGAATCACCCAAAGAGCTTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-962s1c1
Sequence:CCGGGAGCAATTACTCAAGCGTGTTCTCGAGAACACGCTTGAGTAATTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1963s1c1
Sequence:CCGGCCTTGTTAGCTGTGCTTGTATCTCGAGATACAAGCACAGCTAACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1212s1c1
Sequence:CCGGGCAGTGACCTTTAAGTTCTTACTCGAGTAAGAACTTAAAGGTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-665s1c1
Sequence:CCGGCGAGTCGTCCTTGTTTGGAAACTCGAGTTTCCAAACAAGGACGACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-113s1c1
Sequence:CCGGGATGGAAGACAACCGAAGGATCTCGAGATCCTTCGGTTGTCTTCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1920s1c1
Sequence:CCGGCCTCATTAAACATTCCACATACTCGAGTATGTGGAATGTTTAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139200
CYTIP MISSION shRNA Lentiviral Transduction Particles
cytohesin 1 interacting protein
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-327s1c1
Sequence:CCGGGTGTGCACTATGATCTGCAAACTCGAGTTTGCAGATCATAGTGCACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175697    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-196s1c1
Sequence:CCGGGATCAAGCTCTTTGGGTGATTCTCGAGAATCACCCAAAGAGCTTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-962s1c1
Sequence:CCGGGAGCAATTACTCAAGCGTGTTCTCGAGAACACGCTTGAGTAATTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1963s1c1
Sequence:CCGGCCTTGTTAGCTGTGCTTGTATCTCGAGATACAAGCACAGCTAACAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174811    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1212s1c1
Sequence:CCGGGCAGTGACCTTTAAGTTCTTACTCGAGTAAGAACTTAAAGGTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139200.2-665s1c1
Sequence:CCGGCGAGTCGTCCTTGTTTGGAAACTCGAGTTTCCAAACAAGGACGACTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139200.2-113s1c1
Sequence:CCGGGATGGAAGACAACCGAAGGATCTCGAGATCCTTCGGTTGTCTTCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175230    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_139200.2-1920s1c1
Sequence:CCGGCCTCATTAAACATTCCACATACTCGAGTATGTGGAATGTTTAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004288
CYTIP MISSION shRNA Bacterial Glycerol Stock
cytohesin 1 interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-869s1c1
Sequence:CCGGGTACAGATGATGAGTGCTTTACTCGAGTAAAGCACTCATCATCTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-741s1c1
Sequence:CCGGCCGGAATCGATTATCCAGTGACTCGAGTCACTGGATAATCGATTCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1090s1c1
Sequence:CCGGGAAGAGGAAGAAAGTCGCTTTCTCGAGAAAGCGACTTTCTTCCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-918s1c1
Sequence:CCGGGAGGTCATCTTCAAGGAGGAACTCGAGTTCCTCCTTGAAGATGACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-128s1c1
Sequence:CCGGGCAGCCTTACGATGAACGATACTCGAGTATCGTTCATCGTAAGGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1029s1c1
Sequence:CCGGCAGAAAGGGAAGTGTCCGAAACTCGAGTTTCGGACACTTCCCTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-205s1c1
Sequence:CCGGCAGCTTGCTTTGACCAGATCACTCGAGTGATCTGGTCAAAGCAAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-66s1c1
Sequence:CCGGCAATGGCAATTTGGCGGACTTCTCGAGAAGTCCGCCAAATTGCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-1023s1c1
Sequence:CCGGGAAGAGCAGAAAGGGAAGTGTCTCGAGACACTTCCCTTTCTGCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004288
CYTIP MISSION shRNA shRNA Plasmid DNA
cytohesin 1 interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-869s1c1
Sequence:CCGGGTACAGATGATGAGTGCTTTACTCGAGTAAAGCACTCATCATCTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-741s1c1
Sequence:CCGGCCGGAATCGATTATCCAGTGACTCGAGTCACTGGATAATCGATTCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1090s1c1
Sequence:CCGGGAAGAGGAAGAAAGTCGCTTTCTCGAGAAAGCGACTTTCTTCCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-918s1c1
Sequence:CCGGGAGGTCATCTTCAAGGAGGAACTCGAGTTCCTCCTTGAAGATGACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-128s1c1
Sequence:CCGGGCAGCCTTACGATGAACGATACTCGAGTATCGTTCATCGTAAGGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1029s1c1
Sequence:CCGGCAGAAAGGGAAGTGTCCGAAACTCGAGTTTCGGACACTTCCCTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-205s1c1
Sequence:CCGGCAGCTTGCTTTGACCAGATCACTCGAGTGATCTGGTCAAAGCAAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-66s1c1
Sequence:CCGGCAATGGCAATTTGGCGGACTTCTCGAGAAGTCCGCCAAATTGCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-1023s1c1
Sequence:CCGGGAAGAGCAGAAAGGGAAGTGTCTCGAGACACTTCCCTTTCTGCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004288
CYTIP MISSION shRNA Lentiviral Transduction Particles
cytohesin 1 interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-869s1c1
Sequence:CCGGGTACAGATGATGAGTGCTTTACTCGAGTAAAGCACTCATCATCTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-741s1c1
Sequence:CCGGCCGGAATCGATTATCCAGTGACTCGAGTCACTGGATAATCGATTCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1090s1c1
Sequence:CCGGGAAGAGGAAGAAAGTCGCTTTCTCGAGAAAGCGACTTTCTTCCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142064    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-918s1c1
Sequence:CCGGGAGGTCATCTTCAAGGAGGAACTCGAGTTCCTCCTTGAAGATGACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-128s1c1
Sequence:CCGGGCAGCCTTACGATGAACGATACTCGAGTATCGTTCATCGTAAGGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004288.2-1029s1c1
Sequence:CCGGCAGAAAGGGAAGTGTCCGAAACTCGAGTTTCGGACACTTCCCTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141161    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-205s1c1
Sequence:CCGGCAGCTTGCTTTGACCAGATCACTCGAGTGATCTGGTCAAAGCAAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-66s1c1
Sequence:CCGGCAATGGCAATTTGGCGGACTTCTCGAGAAGTCCGCCAAATTGCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004288.2-1023s1c1
Sequence:CCGGGAAGAGCAGAAAGGGAAGTGTCTCGAGACACTTCCCTTTCTGCTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)