EMAIL THIS PAGE TO A FRIEND

CYTL1

cytokine-like 1

62 Gene Product Result for
Synonyms: C17 C4orf4
UniProtKB ID: Q9NRR1
Gene ID:
Human(54360) Summary: C17 is a cytokine-like protein specifically expressed in bone marrow and cord blood mononuclear cells that bear the CD34 (MIM 142230) surface marker (Liu et al., 2000 [PubMed 10857752]
Mouse(231162) cytokine-like 1
Rat(498392) cytokine like 1
sheep(101113759) cytokine-like 1
naked mole-rat(101707204) cytokine-like 1
chicken(422849) cytokine-like 1
cow(505170) cytokine-like 1
dog(611137) cytokine-like 1
domestic cat(101093015) cytokine-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502244 Anti-CYTL1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018659 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081106 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081106 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081106 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018659 Rosetta Predictions human pricing
NM_001134604 Rosetta Predictions rat pricing
NM_001081106 Rosetta Predictions mouse pricing
XM_132070 Rosetta Predictions mouse pricing
XM_899194 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352162 predicted 327
2 SASI_Hs01_00236906 predicted 477
3 SASI_Hs01_00236907 predicted 702
4 SASI_Hs01_00236908 predicted 594
5 SASI_Hs01_00236909 predicted 456
6 SASI_Hs01_00236911 predicted 591
7 SASI_Hs01_00236912 predicted 751
8 SASI_Hs01_00236913 predicted 677
9 SASI_Hs01_00236914 predicted 510
10 SASI_Hs01_00236915 predicted 199
11 SASI_Hs01_00236910 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257519 predicted 336
2 SASI_Rn02_00257520 predicted 758
3 SASI_Rn02_00257521 predicted 580
4 SASI_Rn02_00257522 predicted 576
5 SASI_Rn02_00257523 predicted 671
6 SASI_Rn02_00257524 predicted 846
7 SASI_Rn02_00257525 predicted 490
8 SASI_Rn02_00257526 predicted 830
9 SASI_Rn02_00257527 predicted 479
10 SASI_Rn02_00257528 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081106 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295241 predicted 709
2 SASI_Mm02_00295242 predicted 512
3 SASI_Mm02_00295243 predicted 643
4 SASI_Mm02_00295244 predicted 251
5 SASI_Mm02_00295245 predicted 358
6 SASI_Mm02_00295246 predicted 587
7 SASI_Mm02_00295247 predicted 217
8 SASI_Mm02_00295248 predicted 441
9 SASI_Mm02_00295249 predicted 438
10 SASI_Mm02_00295250 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_132070 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210447 predicted 716
2 SASI_Mm01_00210448 predicted 590
3 SASI_Mm01_00210449 predicted 570
4 SASI_Mm01_00210450 predicted 645
5 SASI_Mm01_00210451 predicted 590
6 SASI_Mm01_00210452 predicted 637
7 SASI_Mm01_00210453 predicted 646
8 SASI_Mm01_00210454 predicted 561
9 SASI_Mm01_00210455 predicted 644
10 SASI_Mm01_00210456 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899194 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00258292 predicted 384
2 SASI_Mm01_00258293 predicted 325
3 SASI_Mm01_00258294 predicted 333
4 SASI_Mm01_00258295 predicted 340
5 SASI_Mm01_00258296 predicted 364
6 SASI_Mm01_00258297 predicted 373
7 SASI_Mm01_00258298 predicted 304
8 SASI_Mm01_00258299 predicted 312
9 SASI_Mm01_00258300 predicted 281
10 SASI_Mm01_00258301 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018659
CYTL1 MISSION shRNA Bacterial Glycerol Stock
cytokine-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018659.2-680s1c1
Sequence:CCGGGCATGTTGATTTGGTCACTAACTCGAGTTAGTGACCAAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-367s1c1
Sequence:CCGGGTTGGATGACTGCAATGCCTTCTCGAGAAGGCATTGCAGTCATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-200s1c1
Sequence:CCGGCCCAGGCTGTACCTGGACATACTCGAGTATGTCCAGGTACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-290s1c1
Sequence:CCGGGTAGATTCCTTGAAGGACAAACTCGAGTTTGTCCTTCAAGGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-208s1c1
Sequence:CCGGGTACCTGGACATACACAATTACTCGAGTAATTGTGTATGTCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-656s21c1
Sequence:CCGGCTTGCCAGGATGGTTAGATACCTCGAGGTATCTAACCATCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-604s21c1
Sequence:CCGGCTCCTTTGAGCATAGAGTTAGCTCGAGCTAACTCTATGCTCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018659.2-344s21c1
Sequence:CCGGTGCAGGAGAGATTTGGTATTCCTCGAGGAATACCAAATCTCTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018659
CYTL1 MISSION shRNA shRNA Plasmid DNA
cytokine-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018659.2-680s1c1
Sequence:CCGGGCATGTTGATTTGGTCACTAACTCGAGTTAGTGACCAAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-367s1c1
Sequence:CCGGGTTGGATGACTGCAATGCCTTCTCGAGAAGGCATTGCAGTCATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-200s1c1
Sequence:CCGGCCCAGGCTGTACCTGGACATACTCGAGTATGTCCAGGTACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-290s1c1
Sequence:CCGGGTAGATTCCTTGAAGGACAAACTCGAGTTTGTCCTTCAAGGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-208s1c1
Sequence:CCGGGTACCTGGACATACACAATTACTCGAGTAATTGTGTATGTCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-656s21c1
Sequence:CCGGCTTGCCAGGATGGTTAGATACCTCGAGGTATCTAACCATCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-604s21c1
Sequence:CCGGCTCCTTTGAGCATAGAGTTAGCTCGAGCTAACTCTATGCTCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018659.2-344s21c1
Sequence:CCGGTGCAGGAGAGATTTGGTATTCCTCGAGGAATACCAAATCTCTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018659
CYTL1 MISSION shRNA Lentiviral Transduction Particles
cytokine-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061743    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018659.2-680s1c1
Sequence:CCGGGCATGTTGATTTGGTCACTAACTCGAGTTAGTGACCAAATCAACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-367s1c1
Sequence:CCGGGTTGGATGACTGCAATGCCTTCTCGAGAAGGCATTGCAGTCATCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-200s1c1
Sequence:CCGGCCCAGGCTGTACCTGGACATACTCGAGTATGTCCAGGTACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-290s1c1
Sequence:CCGGGTAGATTCCTTGAAGGACAAACTCGAGTTTGTCCTTCAAGGAATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018659.2-208s1c1
Sequence:CCGGGTACCTGGACATACACAATTACTCGAGTAATTGTGTATGTCCAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-656s21c1
Sequence:CCGGCTTGCCAGGATGGTTAGATACCTCGAGGTATCTAACCATCCTGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018659.2-604s21c1
Sequence:CCGGCTCCTTTGAGCATAGAGTTAGCTCGAGCTAACTCTATGCTCAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018659.2-344s21c1
Sequence:CCGGTGCAGGAGAGATTTGGTATTCCTCGAGGAATACCAAATCTCTCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081106
CYTL1 MISSION shRNA Bacterial Glycerol Stock
cytokine-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-191s21c1
Sequence:CCGGGGATTCCTGTGTGAGGTACTTCTCGAGAAGTACCTCACACAGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-326s21c1
Sequence:CCGGGCGGAAGCTGTATACCATCATCTCGAGATGATGGTATACAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081106.1-647s21c1
Sequence:CCGGGGTGTCTCATTGGAATGTAAGCTCGAGCTTACATTCCAATGAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-393s21c1
Sequence:CCGGAGTGCCTTAGAAGACCCAATTCTCGAGAATTGGGTCTTCTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-218s21c1
Sequence:CCGGGCTTTACCTGGACATCCATAACTCGAGTTATGGATGTCCAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081106
CYTL1 MISSION shRNA shRNA Plasmid DNA
cytokine-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-191s21c1
Sequence:CCGGGGATTCCTGTGTGAGGTACTTCTCGAGAAGTACCTCACACAGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-326s21c1
Sequence:CCGGGCGGAAGCTGTATACCATCATCTCGAGATGATGGTATACAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081106.1-647s21c1
Sequence:CCGGGGTGTCTCATTGGAATGTAAGCTCGAGCTTACATTCCAATGAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-393s21c1
Sequence:CCGGAGTGCCTTAGAAGACCCAATTCTCGAGAATTGGGTCTTCTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-218s21c1
Sequence:CCGGGCTTTACCTGGACATCCATAACTCGAGTTATGGATGTCCAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081106
CYTL1 MISSION shRNA Lentiviral Transduction Particles
cytokine-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-191s21c1
Sequence:CCGGGGATTCCTGTGTGAGGTACTTCTCGAGAAGTACCTCACACAGGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-326s21c1
Sequence:CCGGGCGGAAGCTGTATACCATCATCTCGAGATGATGGTATACAGCTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081106.1-647s21c1
Sequence:CCGGGGTGTCTCATTGGAATGTAAGCTCGAGCTTACATTCCAATGAGACACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-393s21c1
Sequence:CCGGAGTGCCTTAGAAGACCCAATTCTCGAGAATTGGGTCTTCTAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081106.1-218s21c1
Sequence:CCGGGCTTTACCTGGACATCCATAACTCGAGTTATGGATGTCCAGGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks