EMAIL THIS PAGE TO A FRIEND

CYYR1

cysteine/tyrosine-rich 1

171 Gene Product Result for
Synonyms: C21orf95
UniProtKB ID: Q96J86, B2R845, Q53ER3, Q5JPD0, Q96NV7
Gene ID:
Mouse(224405) cysteine and tyrosine-rich protein 1
Rat(304138) cysteine/tyrosine-rich 1
Zebrafish(405818) cysteine and tyrosine-rich protein 1
cow(768230) cysteine/tyrosine-rich 1
domestic cat(101099236) cysteine/tyrosine-rich 1
dog(478395) cysteine/tyrosine-rich 1
chicken(770067) cysteine/tyrosine-rich 1
sheep(101111331) cysteine/tyrosine-rich 1
naked mole-rat(101697057) cysteine/tyrosine-rich 1
domestic guinea pig(100725998) cysteine/tyrosine-rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144853 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144853 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144853 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052954 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052954 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052954 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022451 MISSION® esiRNA esiRNA human CYYR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052954 Rosetta Predictions human pricing
NM_001013980 Rosetta Predictions rat pricing
NM_144853 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191077 predicted 388
2 SASI_Hs01_00191078 predicted 694
3 SASI_Hs01_00191079 predicted 453
4 SASI_Hs02_00361754 predicted 665
5 SASI_Hs01_00191080 predicted 462
6 SASI_Hs01_00191081 predicted 551
7 SASI_Hs01_00191083 predicted 412
8 SASI_Hs02_00361755 predicted 468
9 SASI_Hs01_00191084 predicted 364
10 SASI_Hs01_00191085 predicted 638
11 SASI_Hs01_00191076 predicted 475
12 SASI_Hs01_00191082 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013980 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086365 predicted 800
2 SASI_Rn01_00086366 predicted 1258
3 SASI_Rn01_00086367 predicted 760
4 SASI_Rn01_00086368 predicted 437
5 SASI_Rn01_00086369 predicted 1143
6 SASI_Rn01_00086370 predicted 1110
7 SASI_Rn01_00086371 predicted 1130
8 SASI_Rn01_00086372 predicted 1053
9 SASI_Rn01_00086373 predicted 1126
10 SASI_Rn01_00086374 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144853 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110997 predicted 1231
2 SASI_Mm01_00110998 predicted 970
3 SASI_Mm02_00340263 predicted 571
4 SASI_Mm01_00111001 predicted 1215
5 SASI_Mm01_00111002 predicted 969
6 SASI_Mm01_00111003 predicted 892
7 SASI_Mm01_00111004 predicted 987
8 SASI_Mm01_00111005 predicted 1023
9 SASI_Mm01_00111000 predicted 829
10 SASI_Mm02_00340264 predicted 300
11 SASI_Mm01_00110999 predicted 1067
12 SASI_Mm01_00111006 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144853
CYYR1 MISSION shRNA Bacterial Glycerol Stock
cysteine/tyrosine-rich 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-705s21c1
Sequence:CCGGCGTATCCTGGAAATCCAAGGACTCGAGTCCTTGGATTTCCAGGATACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-1111s21c1
Sequence:CCGGGAACTAGAACAGATCGTTATTCTCGAGAATAACGATCTGTTCTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-885s21c1
Sequence:CCGGAGAGCTAGGTGGAGAATTATGCTCGAGCATAATTCTCCACCTAGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-643s21c1
Sequence:CCGGAGACCTGCCACCTCCATACTCCTCGAGGAGTATGGAGGTGGCAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-308s1c1
Sequence:CCGGCCGAAGTTGATCCTGCTCTTTCTCGAGAAAGAGCAGGATCAACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-463s1c1
Sequence:CCGGCGTGTTTGGAATCGTGTTCATCTCGAGATGAACACGATTCCAAACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-739s1c1
Sequence:CCGGCCAGAACAGAATACGTGACAACTCGAGTTGTCACGTATTCTGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144853.2-834s1c1
Sequence:CCGGCGATAATATCTCAGGCAGAATCTCGAGATTCTGCCTGAGATATTATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144853
CYYR1 MISSION shRNA shRNA Plasmid DNA
cysteine/tyrosine-rich 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-705s21c1
Sequence:CCGGCGTATCCTGGAAATCCAAGGACTCGAGTCCTTGGATTTCCAGGATACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-1111s21c1
Sequence:CCGGGAACTAGAACAGATCGTTATTCTCGAGAATAACGATCTGTTCTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-885s21c1
Sequence:CCGGAGAGCTAGGTGGAGAATTATGCTCGAGCATAATTCTCCACCTAGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-643s21c1
Sequence:CCGGAGACCTGCCACCTCCATACTCCTCGAGGAGTATGGAGGTGGCAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-308s1c1
Sequence:CCGGCCGAAGTTGATCCTGCTCTTTCTCGAGAAAGAGCAGGATCAACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-463s1c1
Sequence:CCGGCGTGTTTGGAATCGTGTTCATCTCGAGATGAACACGATTCCAAACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-739s1c1
Sequence:CCGGCCAGAACAGAATACGTGACAACTCGAGTTGTCACGTATTCTGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000124909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144853.2-834s1c1
Sequence:CCGGCGATAATATCTCAGGCAGAATCTCGAGATTCTGCCTGAGATATTATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144853
CYYR1 MISSION shRNA Lentiviral Transduction Particles
cysteine/tyrosine-rich 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-705s21c1
Sequence:CCGGCGTATCCTGGAAATCCAAGGACTCGAGTCCTTGGATTTCCAGGATACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-1111s21c1
Sequence:CCGGGAACTAGAACAGATCGTTATTCTCGAGAATAACGATCTGTTCTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144853.3-885s21c1
Sequence:CCGGAGAGCTAGGTGGAGAATTATGCTCGAGCATAATTCTCCACCTAGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144853.3-643s21c1
Sequence:CCGGAGACCTGCCACCTCCATACTCCTCGAGGAGTATGGAGGTGGCAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-308s1c1
Sequence:CCGGCCGAAGTTGATCCTGCTCTTTCTCGAGAAAGAGCAGGATCAACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-463s1c1
Sequence:CCGGCGTGTTTGGAATCGTGTTCATCTCGAGATGAACACGATTCCAAACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144853.2-739s1c1
Sequence:CCGGCCAGAACAGAATACGTGACAACTCGAGTTGTCACGTATTCTGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000124909    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144853.2-834s1c1
Sequence:CCGGCGATAATATCTCAGGCAGAATCTCGAGATTCTGCCTGAGATATTATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052954
CYYR1 MISSION shRNA Bacterial Glycerol Stock
cysteine/tyrosine-rich 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-422s1c1
Sequence:CCGGGATTGCAAATCTTACTGCTGTCTCGAGACAGCAGTAAGATTTGCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-380s1c1
Sequence:CCGGCTCTTTGTCTACGCAGATGATCTCGAGATCATCTGCGTAGACAAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1426s1c1
Sequence:CCGGCCTCAGAAGTTCTGCTCGTATCTCGAGATACGAGCAGAACTTCTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-689s1c1
Sequence:CCGGGAATACTGTGCAGACTTGCCTCTCGAGAGGCAAGTCTGCACAGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-677s1c1
Sequence:CCGGGACCACGAGATGGAATACTGTCTCGAGACAGTATTCCATCTCGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-379s1c1
Sequence:CCGGGCTCTTTGTCTACGCAGATGACTCGAGTCATCTGCGTAGACAAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-386s1c1
Sequence:CCGGGTCTACGCAGATGATTGCCTTCTCGAGAAGGCAATCATCTGCGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-2602s1c1
Sequence:CCGGGCCAGGGTTTCTGTGATGATTCTCGAGAATCATCACAGAAACCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1479s1c1
Sequence:CCGGCCAGGAGTGAATACAACAGAACTCGAGTTCTGTTGTATTCACTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-565s1c1
Sequence:CCGGCATATGCATCTGCATGTGCATCTCGAGATGCACATGCAGATGCATATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052954
CYYR1 MISSION shRNA shRNA Plasmid DNA
cysteine/tyrosine-rich 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-422s1c1
Sequence:CCGGGATTGCAAATCTTACTGCTGTCTCGAGACAGCAGTAAGATTTGCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-380s1c1
Sequence:CCGGCTCTTTGTCTACGCAGATGATCTCGAGATCATCTGCGTAGACAAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1426s1c1
Sequence:CCGGCCTCAGAAGTTCTGCTCGTATCTCGAGATACGAGCAGAACTTCTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-689s1c1
Sequence:CCGGGAATACTGTGCAGACTTGCCTCTCGAGAGGCAAGTCTGCACAGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-677s1c1
Sequence:CCGGGACCACGAGATGGAATACTGTCTCGAGACAGTATTCCATCTCGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-379s1c1
Sequence:CCGGGCTCTTTGTCTACGCAGATGACTCGAGTCATCTGCGTAGACAAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-386s1c1
Sequence:CCGGGTCTACGCAGATGATTGCCTTCTCGAGAAGGCAATCATCTGCGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-2602s1c1
Sequence:CCGGGCCAGGGTTTCTGTGATGATTCTCGAGAATCATCACAGAAACCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1479s1c1
Sequence:CCGGCCAGGAGTGAATACAACAGAACTCGAGTTCTGTTGTATTCACTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-565s1c1
Sequence:CCGGCATATGCATCTGCATGTGCATCTCGAGATGCACATGCAGATGCATATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052954
CYYR1 MISSION shRNA Lentiviral Transduction Particles
cysteine/tyrosine-rich 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-422s1c1
Sequence:CCGGGATTGCAAATCTTACTGCTGTCTCGAGACAGCAGTAAGATTTGCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-380s1c1
Sequence:CCGGCTCTTTGTCTACGCAGATGATCTCGAGATCATCTGCGTAGACAAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1426s1c1
Sequence:CCGGCCTCAGAAGTTCTGCTCGTATCTCGAGATACGAGCAGAACTTCTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141881    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-689s1c1
Sequence:CCGGGAATACTGTGCAGACTTGCCTCTCGAGAGGCAAGTCTGCACAGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052954.2-677s1c1
Sequence:CCGGGACCACGAGATGGAATACTGTCTCGAGACAGTATTCCATCTCGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-379s1c1
Sequence:CCGGGCTCTTTGTCTACGCAGATGACTCGAGTCATCTGCGTAGACAAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142316    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-386s1c1
Sequence:CCGGGTCTACGCAGATGATTGCCTTCTCGAGAAGGCAATCATCTGCGTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142521    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-2602s1c1
Sequence:CCGGGCCAGGGTTTCTGTGATGATTCTCGAGAATCATCACAGAAACCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143114    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_052954.2-1479s1c1
Sequence:CCGGCCAGGAGTGAATACAACAGAACTCGAGTTCTGTTGTATTCACTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052954.2-565s1c1
Sequence:CCGGCATATGCATCTGCATGTGCATCTCGAGATGCACATGCAGATGCATATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)