EMAIL THIS PAGE TO A FRIEND

D2HGDH

D-2-hydroxyglutarate dehydrogenase

56 Gene Product Result for
Synonyms: D2HGD
UniProtKB ID: Q8N465, Q6IQ24, Q8N5Q8
Gene ID:
Human(728294) Summary: This gene encodes D-2hydroxyglutarate dehydrogenase, a mitochondrial enzyme belonging to the FAD-binding oxidoreductase/transferase type 4 family. This enzyme, which is most active in liver and kidney but also active in heart and brain, converts D-2-hydroxyglutarate to 2-ketoglutarate. Mutations in this gene are present in D-2-hydroxyglutaric aciduria, a rare recessive neurometabolic disorder causing developmental delay, epilepsy, hypotonia, and dysmorphic features. [provided by RefSeq, Jul 2008]
Mouse(98314) D-2-hydroxyglutarate dehydrogenase
Rat(301624) D-2-hydroxyglutarate dehydrogenase
sheep(101121480) D-2-hydroxyglutarate dehydrogenase
Domestic Rabbit(100343021) D-2-hydroxyglutarate dehydrogenase
domestic guinea pig(100730010) D-2-hydroxyglutarate dehydrogenase
naked mole-rat(101721825) D-2-hydroxyglutarate dehydrogenase
Zebrafish(565889) D-2-hydroxyglutarate dehydrogenase
cow(533003) D-2-hydroxyglutarate dehydrogenase
domestic cat(101098076) D-2-hydroxyglutarate dehydrogenase
dog(609641) D-2-hydroxyglutarate dehydrogenase
chicken(424853) D-2-hydroxyglutarate dehydrogenase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152783 Rosetta Predictions human pricing
NM_001106926 Rosetta Predictions rat pricing
XR_008638 Rosetta Predictions rat pricing
NM_178882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212316 predicted 1480
2 SASI_Hs01_00212317 predicted 1448
3 SASI_Hs01_00212318 predicted 1392
4 SASI_Hs02_00366725 predicted 1034
5 SASI_Hs01_00212320 predicted 1462
6 SASI_Hs01_00212321 predicted 625
7 SASI_Hs01_00212322 predicted 719
8 SASI_Hs01_00212323 predicted 1221
9 SASI_Hs01_00212324 predicted 607
10 SASI_Hs01_00212325 predicted 426
11 SASI_Hs01_00212319 predicted 1063
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106926 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223766 predicted 728
2 SASI_Rn02_00223767 predicted 1583
3 SASI_Rn02_00223768 predicted 1134
4 SASI_Rn02_00223769 predicted 644
5 SASI_Rn02_00223770 predicted 1371
6 SASI_Rn02_00223771 predicted 1247
7 SASI_Rn02_00223772 predicted 855
8 SASI_Rn02_00223773 predicted 1178
9 SASI_Rn02_00223774 predicted 605
10 SASI_Rn02_00223775 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00177957 predicted 410
2 SASI_Rn01_00177958 predicted 2543
3 SASI_Rn01_00177959 predicted 2588
4 SASI_Rn01_00177960 predicted 325
5 SASI_Rn01_00177961 predicted 408
6 SASI_Rn01_00177962 predicted 1048
7 SASI_Rn01_00177963 predicted 931
8 SASI_Rn01_00177964 predicted 2483
9 SASI_Rn01_00177965 predicted 537
10 SASI_Rn01_00177966 predicted 2413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135733 predicted 481
2 SASI_Mm01_00135734 predicted 1333
3 SASI_Mm01_00135735 predicted 1805
4 SASI_Mm02_00349467 predicted 612
5 SASI_Mm01_00135736 predicted 975
6 SASI_Mm01_00135737 predicted 1502
7 SASI_Mm01_00135738 predicted 1045
8 SASI_Mm01_00135740 predicted 482
9 SASI_Mm01_00135741 predicted 1123
10 SASI_Mm01_00135742 predicted 1190
11 SASI_Mm01_00135739 predicted 1373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152783
D2HGDH MISSION shRNA Bacterial Glycerol Stock
D-2-hydroxyglutarate dehydrogenase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1066s1c1
Sequence:CCGGCCTGTCTGCATTCGAGTTCATCTCGAGATGAACTCGAATGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-630s1c1
Sequence:CCGGGCGTGTCTGGAATTCTGGTTTCTCGAGAAACCAGAATTCCAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1270s1c1
Sequence:CCGGCGACCAGAGGAAAGTCAAGATCTCGAGATCTTGACTTTCCTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-319s1c1
Sequence:CCGGGCCGTTCTCCACGGTGTCTAACTCGAGTTAGACACCGTGGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1136s1c1
Sequence:CCGGCCGGTGCAAGAGAGTCCGTTTCTCGAGAAACGGACTCTCTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-730s21c1
Sequence:CCGGTCATCATGCCGCTGGACTTAGCTCGAGCTAAGTCCAGCGGCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-594s21c1
Sequence:CCGGCCCGTCTTTGACGAGATCATCCTCGAGGATGATCTCGTCAAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-1180s21c1
Sequence:CCGGTTTACGTCCTCATCGAGACTTCTCGAGAAGTCTCGATGAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152783.3-2399s21c1
Sequence:CCGGTCGGGTTCTGCTCCTACAAAGCTCGAGCTTTGTAGGAGCAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-801s21c1
Sequence:CCGGGGCCTGCGGTTTCTTCGATATCTCGAGATATCGAAGAAACCGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152783
D2HGDH MISSION shRNA shRNA Plasmid DNA
D-2-hydroxyglutarate dehydrogenase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1066s1c1
Sequence:CCGGCCTGTCTGCATTCGAGTTCATCTCGAGATGAACTCGAATGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-630s1c1
Sequence:CCGGGCGTGTCTGGAATTCTGGTTTCTCGAGAAACCAGAATTCCAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1270s1c1
Sequence:CCGGCGACCAGAGGAAAGTCAAGATCTCGAGATCTTGACTTTCCTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-319s1c1
Sequence:CCGGGCCGTTCTCCACGGTGTCTAACTCGAGTTAGACACCGTGGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1136s1c1
Sequence:CCGGCCGGTGCAAGAGAGTCCGTTTCTCGAGAAACGGACTCTCTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-730s21c1
Sequence:CCGGTCATCATGCCGCTGGACTTAGCTCGAGCTAAGTCCAGCGGCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-594s21c1
Sequence:CCGGCCCGTCTTTGACGAGATCATCCTCGAGGATGATCTCGTCAAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-1180s21c1
Sequence:CCGGTTTACGTCCTCATCGAGACTTCTCGAGAAGTCTCGATGAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152783.3-2399s21c1
Sequence:CCGGTCGGGTTCTGCTCCTACAAAGCTCGAGCTTTGTAGGAGCAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-801s21c1
Sequence:CCGGGGCCTGCGGTTTCTTCGATATCTCGAGATATCGAAGAAACCGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152783
D2HGDH MISSION shRNA Lentiviral Transduction Particles
D-2-hydroxyglutarate dehydrogenase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1066s1c1
Sequence:CCGGCCTGTCTGCATTCGAGTTCATCTCGAGATGAACTCGAATGCAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-630s1c1
Sequence:CCGGGCGTGTCTGGAATTCTGGTTTCTCGAGAAACCAGAATTCCAGACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1270s1c1
Sequence:CCGGCGACCAGAGGAAAGTCAAGATCTCGAGATCTTGACTTTCCTCTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-319s1c1
Sequence:CCGGGCCGTTCTCCACGGTGTCTAACTCGAGTTAGACACCGTGGAGAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152783.2-1136s1c1
Sequence:CCGGCCGGTGCAAGAGAGTCCGTTTCTCGAGAAACGGACTCTCTTGCACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-730s21c1
Sequence:CCGGTCATCATGCCGCTGGACTTAGCTCGAGCTAAGTCCAGCGGCATGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-594s21c1
Sequence:CCGGCCCGTCTTTGACGAGATCATCCTCGAGGATGATCTCGTCAAAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-1180s21c1
Sequence:CCGGTTTACGTCCTCATCGAGACTTCTCGAGAAGTCTCGATGAGGACGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152783.3-2399s21c1
Sequence:CCGGTCGGGTTCTGCTCCTACAAAGCTCGAGCTTTGTAGGAGCAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152783.3-801s21c1
Sequence:CCGGGGCCTGCGGTTTCTTCGATATCTCGAGATATCGAAGAAACCGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178882
VALIDATED
D2HGDH MISSION shRNA Bacterial Glycerol Stock
D-2-hydroxyglutarate dehydrogenase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-2336s1c1
Sequence:CCGGGCCTGGTTCAAATTCTGCTTTCTCGAGAAAGCAGAATTTGAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-1954s1c1
Sequence:CCGGCCTGCTTTGTTGCATCTCTATCTCGAGATAGAGATGCAACAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178882.2-442s1c1
Sequence:CCGGGCACTGCTATAAGAGGAACTTCTCGAGAAGTTCCTCTTATAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-360s21c1
Sequence:CCGGCATCATACCTGGCAGAGTTATCTCGAGATAACTCTGCCAGGTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-2018s21c1
Sequence:CCGGTGCATCTCTATAGCGTGTAATCTCGAGATTACACGCTATAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178882.3-1136s21c1
Sequence:CCGGTACAAGAGAGTCCATTCTATGCTCGAGCATAGAATGGACTCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-487s21c1
Sequence:CCGGATTCTTAGGCACTGCTATAAGCTCGAGCTTATAGCAGTGCCTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-1505s21c1
Sequence:CCGGTCGGTGCCTTGGAACCTTATGCTCGAGCATAAGGTTCCAAGGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178882
VALIDATED
D2HGDH MISSION shRNA shRNA Plasmid DNA
D-2-hydroxyglutarate dehydrogenase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-2336s1c1
Sequence:CCGGGCCTGGTTCAAATTCTGCTTTCTCGAGAAAGCAGAATTTGAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-1954s1c1
Sequence:CCGGCCTGCTTTGTTGCATCTCTATCTCGAGATAGAGATGCAACAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178882.2-442s1c1
Sequence:CCGGGCACTGCTATAAGAGGAACTTCTCGAGAAGTTCCTCTTATAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-360s21c1
Sequence:CCGGCATCATACCTGGCAGAGTTATCTCGAGATAACTCTGCCAGGTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-2018s21c1
Sequence:CCGGTGCATCTCTATAGCGTGTAATCTCGAGATTACACGCTATAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178882.3-1136s21c1
Sequence:CCGGTACAAGAGAGTCCATTCTATGCTCGAGCATAGAATGGACTCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-487s21c1
Sequence:CCGGATTCTTAGGCACTGCTATAAGCTCGAGCTTATAGCAGTGCCTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-1505s21c1
Sequence:CCGGTCGGTGCCTTGGAACCTTATGCTCGAGCATAAGGTTCCAAGGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178882
VALIDATED
D2HGDH MISSION shRNA Lentiviral Transduction Particles
D-2-hydroxyglutarate dehydrogenase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201852    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-2336s1c1
Sequence:CCGGGCCTGGTTCAAATTCTGCTTTCTCGAGAAAGCAGAATTTGAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190926    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178882.2-1954s1c1
Sequence:CCGGCCTGCTTTGTTGCATCTCTATCTCGAGATAGAGATGCAACAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190831    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178882.2-442s1c1
Sequence:CCGGGCACTGCTATAAGAGGAACTTCTCGAGAAGTTCCTCTTATAGCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-360s21c1
Sequence:CCGGCATCATACCTGGCAGAGTTATCTCGAGATAACTCTGCCAGGTATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249674    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-2018s21c1
Sequence:CCGGTGCATCTCTATAGCGTGTAATCTCGAGATTACACGCTATAGAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178882.3-1136s21c1
Sequence:CCGGTACAAGAGAGTCCATTCTATGCTCGAGCATAGAATGGACTCTCTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-487s21c1
Sequence:CCGGATTCTTAGGCACTGCTATAAGCTCGAGCTTATAGCAGTGCCTAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178882.3-1505s21c1
Sequence:CCGGTCGGTGCCTTGGAACCTTATGCTCGAGCATAAGGTTCCAAGGCACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks