EMAIL THIS PAGE TO A FRIEND

DAAM1

dishevelled associated activator of morphogenesis 1

137 Gene Product Result for
UniProtKB ID: Q9Y4D1, Q86U34, Q8N1Z8, Q8TB39
Gene ID:
Human(23002) Summary: Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
Mouse(208846) dishevelled associated activator of morphogenesis 1
Rat(314212) dishevelled associated activator of morphogenesis 1
chicken(423532) dishevelled associated activator of morphogenesis 1
dog(490714) dishevelled associated activator of morphogenesis 1
domestic cat(101098546) dishevelled associated activator of morphogenesis 1
Horse(100051203) dishevelled associated activator of morphogenesis 1
cow(513742) dishevelled associated activator of morphogenesis 1
domestic guinea pig(100719981) dishevelled associated activator of morphogenesis 1
naked mole-rat(101726077) dishevelled associated activator of morphogenesis 1
sheep(101123636) dishevelled associated activator of morphogenesis 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014992 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014992 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014992 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014992 Rosetta Predictions human pricing
NM_001108030 Rosetta Predictions rat pricing
NM_026102 Rosetta Predictions mouse pricing
NM_172464 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069723 predicted 2303
2 SASI_Hs01_00069724 predicted 1251
3 SASI_Hs01_00069725 predicted 930
4 SASI_Hs01_00069726 predicted 196
5 SASI_Hs02_00346759 predicted 2601
6 SASI_Hs01_00069728 predicted 1306
7 SASI_Hs01_00069729 predicted 2159
8 SASI_Hs02_00346760 predicted 2814
9 SASI_Hs01_00069730 predicted 1292
10 SASI_Hs01_00069731 predicted 1195
11 SASI_Hs01_00069722 predicted 2735
12 SASI_Hs01_00069727 predicted 1350
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108030 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234675 predicted 3326
2 SASI_Rn02_00234676 predicted 407
3 SASI_Rn02_00234677 predicted 796
4 SASI_Rn02_00234678 predicted 2478
5 SASI_Rn02_00234679 predicted 1912
6 SASI_Rn02_00234680 predicted 1495
7 SASI_Rn02_00234681 predicted 1053
8 SASI_Rn02_00234682 predicted 2105
9 SASI_Rn02_00234683 predicted 400
10 SASI_Rn02_00234684 predicted 1510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133151 predicted 1328
2 SASI_Mm01_00133152 predicted 749
3 SASI_Mm01_00133153 predicted 764
4 SASI_Mm01_00133154 predicted 3181
5 SASI_Mm01_00133155 predicted 2760
6 SASI_Mm02_00329676 predicted 1268
7 SASI_Mm01_00133156 predicted 1726
8 SASI_Mm01_00133157 predicted 1453
9 SASI_Mm01_00133158 predicted 1091
10 SASI_Mm01_00133159 predicted 861
11 SASI_Mm01_00133150 predicted 2327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172464 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192464 predicted 1192
2 SASI_Mm01_00192465 predicted 611
3 SASI_Mm01_00192466 predicted 623
4 SASI_Mm01_00192467 predicted 3039
5 SASI_Mm01_00192468 predicted 2631
6 SASI_Mm02_00344000 predicted 1126
7 SASI_Mm01_00192469 predicted 1590
8 SASI_Mm01_00192470 predicted 1320
9 SASI_Mm01_00192471 predicted 958
10 SASI_Mm01_00192472 predicted 721
11 SASI_Mm01_00192463 predicted 2194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014992
DAAM1 MISSION shRNA Bacterial Glycerol Stock
dishevelled associated activator of morphogenesis 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-1038s1c1
Sequence:CCGGCGCTATGAATTTCTGATGTTACTCGAGTAACATCAGAAATTCATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-596s1c1
Sequence:CCGGCCTATCATGTATCCTCAACTTCTCGAGAAGTTGAGGATACATGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014992.1-3676s1c1
Sequence:CCGGGCACAATACTATCTCCTGAAACTCGAGTTTCAGGAGATAGTATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-684s1c1
Sequence:CCGGGCGTTAATGAACAACTCTCAACTCGAGTTGAGAGTTGTTCATTAACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-2964s1c1
Sequence:CCGGGCAGAAGCTAAAGACCTGTTTCTCGAGAAACAGGTCTTTAGCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3287s21c1
Sequence:CCGGACGGAATCGCAAACGTATTACCTCGAGGTAATACGTTTGCGATTCCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-722s21c1
Sequence:CCGGGGCTCATTCTGAGAGTATTAACTCGAGTTAATACTCTCAGAATGAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3390s21c1
Sequence:CCGGGCTCATTAGCAGCCCTCTAAACTCGAGTTTAGAGGGCTGCTAATGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3705s21c1
Sequence:CCGGAGACATTCCCTAGATTCAAAGCTCGAGCTTTGAATCTAGGGAATGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1997s21c1
Sequence:CCGGAGGAACAGTATGGACCGAAATCTCGAGATTTCGGTCCATACTGTTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1428s21c1
Sequence:CCGGGTCGTACGAATGTTGGTTAATCTCGAGATTAACCAACATTCGTACGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1244s21c1
Sequence:CCGGTAGTGAAGCTTACCCGCATTTCTCGAGAAATGCGGGTAAGCTTCACTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3162s21c1
Sequence:CCGGCAACGTGAAAGGGAACGTAAACTCGAGTTTACGTTCCCTTTCACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-2247s21c1
Sequence:CCGGGACGAAATCAAACGGGCAATTCTCGAGAATTGCCCGTTTGATTTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3557s21c1
Sequence:CCAGAGACCTATACGTATGGTTAAACTCGAGTTTAACCATACGTATAGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014992
DAAM1 MISSION shRNA shRNA Plasmid DNA
dishevelled associated activator of morphogenesis 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-1038s1c1
Sequence:CCGGCGCTATGAATTTCTGATGTTACTCGAGTAACATCAGAAATTCATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-596s1c1
Sequence:CCGGCCTATCATGTATCCTCAACTTCTCGAGAAGTTGAGGATACATGATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014992.1-3676s1c1
Sequence:CCGGGCACAATACTATCTCCTGAAACTCGAGTTTCAGGAGATAGTATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-684s1c1
Sequence:CCGGGCGTTAATGAACAACTCTCAACTCGAGTTGAGAGTTGTTCATTAACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-2964s1c1
Sequence:CCGGGCAGAAGCTAAAGACCTGTTTCTCGAGAAACAGGTCTTTAGCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3287s21c1
Sequence:CCGGACGGAATCGCAAACGTATTACCTCGAGGTAATACGTTTGCGATTCCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-722s21c1
Sequence:CCGGGGCTCATTCTGAGAGTATTAACTCGAGTTAATACTCTCAGAATGAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3390s21c1
Sequence:CCGGGCTCATTAGCAGCCCTCTAAACTCGAGTTTAGAGGGCTGCTAATGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3705s21c1
Sequence:CCGGAGACATTCCCTAGATTCAAAGCTCGAGCTTTGAATCTAGGGAATGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1997s21c1
Sequence:CCGGAGGAACAGTATGGACCGAAATCTCGAGATTTCGGTCCATACTGTTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1428s21c1
Sequence:CCGGGTCGTACGAATGTTGGTTAATCTCGAGATTAACCAACATTCGTACGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1244s21c1
Sequence:CCGGTAGTGAAGCTTACCCGCATTTCTCGAGAAATGCGGGTAAGCTTCACTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3162s21c1
Sequence:CCGGCAACGTGAAAGGGAACGTAAACTCGAGTTTACGTTCCCTTTCACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-2247s21c1
Sequence:CCGGGACGAAATCAAACGGGCAATTCTCGAGAATTGCCCGTTTGATTTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3557s21c1
Sequence:CCAGAGACCTATACGTATGGTTAAACTCGAGTTTAACCATACGTATAGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014992
DAAM1 MISSION shRNA Lentiviral Transduction Particles
dishevelled associated activator of morphogenesis 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-1038s1c1
Sequence:CCGGCGCTATGAATTTCTGATGTTACTCGAGTAACATCAGAAATTCATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-596s1c1
Sequence:CCGGCCTATCATGTATCCTCAACTTCTCGAGAAGTTGAGGATACATGATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014992.1-3676s1c1
Sequence:CCGGGCACAATACTATCTCCTGAAACTCGAGTTTCAGGAGATAGTATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-684s1c1
Sequence:CCGGGCGTTAATGAACAACTCTCAACTCGAGTTGAGAGTTGTTCATTAACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014992.1-2964s1c1
Sequence:CCGGGCAGAAGCTAAAGACCTGTTTCTCGAGAAACAGGTCTTTAGCTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3287s21c1
Sequence:CCGGACGGAATCGCAAACGTATTACCTCGAGGTAATACGTTTGCGATTCCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-722s21c1
Sequence:CCGGGGCTCATTCTGAGAGTATTAACTCGAGTTAATACTCTCAGAATGAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3390s21c1
Sequence:CCGGGCTCATTAGCAGCCCTCTAAACTCGAGTTTAGAGGGCTGCTAATGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3705s21c1
Sequence:CCGGAGACATTCCCTAGATTCAAAGCTCGAGCTTTGAATCTAGGGAATGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1997s21c1
Sequence:CCGGAGGAACAGTATGGACCGAAATCTCGAGATTTCGGTCCATACTGTTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1428s21c1
Sequence:CCGGGTCGTACGAATGTTGGTTAATCTCGAGATTAACCAACATTCGTACGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-1244s21c1
Sequence:CCGGTAGTGAAGCTTACCCGCATTTCTCGAGAAATGCGGGTAAGCTTCACTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-3162s21c1
Sequence:CCGGCAACGTGAAAGGGAACGTAAACTCGAGTTTACGTTCCCTTTCACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014992.1-2247s21c1
Sequence:CCGGGACGAAATCAAACGGGCAATTCTCGAGAATTGCCCGTTTGATTTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422055    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014992.1-3557s21c1
Sequence:CCAGAGACCTATACGTATGGTTAAACTCGAGTTTAACCATACGTATAGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026102
DAAM1 MISSION shRNA Bacterial Glycerol Stock
dishevelled associated activator of morphogenesis 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-266s1c1
Sequence:CCGGCGAAACAATGACCATCCAGAACTCGAGTTCTGGATGGTCATTGTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-2342s1c1
Sequence:CCGGCGGGCAATTCTAACAATGGATCTCGAGATCCATTGTTAGAATTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-1513s1c1
Sequence:CCGGCGTCGTAAGAATGTTGGTTAACTCGAGTTAACCAACATTCTTACGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-805s1c1
Sequence:CCGGCCTGGCTCATTCTGAGAGTATCTCGAGATACTCTCAGAATGAGCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026102.1-3700s1c1
Sequence:CCGGGCATTCATATTGAGTGGGATTCTCGAGAATCCCACTCAATATGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026102
DAAM1 MISSION shRNA shRNA Plasmid DNA
dishevelled associated activator of morphogenesis 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-266s1c1
Sequence:CCGGCGAAACAATGACCATCCAGAACTCGAGTTCTGGATGGTCATTGTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-2342s1c1
Sequence:CCGGCGGGCAATTCTAACAATGGATCTCGAGATCCATTGTTAGAATTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-1513s1c1
Sequence:CCGGCGTCGTAAGAATGTTGGTTAACTCGAGTTAACCAACATTCTTACGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-805s1c1
Sequence:CCGGCCTGGCTCATTCTGAGAGTATCTCGAGATACTCTCAGAATGAGCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026102.1-3700s1c1
Sequence:CCGGGCATTCATATTGAGTGGGATTCTCGAGAATCCCACTCAATATGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026102
DAAM1 MISSION shRNA Lentiviral Transduction Particles
dishevelled associated activator of morphogenesis 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-266s1c1
Sequence:CCGGCGAAACAATGACCATCCAGAACTCGAGTTCTGGATGGTCATTGTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-2342s1c1
Sequence:CCGGCGGGCAATTCTAACAATGGATCTCGAGATCCATTGTTAGAATTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-1513s1c1
Sequence:CCGGCGTCGTAAGAATGTTGGTTAACTCGAGTTAACCAACATTCTTACGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026102.1-805s1c1
Sequence:CCGGCCTGGCTCATTCTGAGAGTATCTCGAGATACTCTCAGAATGAGCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120532    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026102.1-3700s1c1
Sequence:CCGGGCATTCATATTGAGTGGGATTCTCGAGAATCCCACTCAATATGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)