EMAIL THIS PAGE TO A FRIEND

DAAM2

dishevelled associated activator of morphogenesis 2

100 Gene Product Result for
Synonyms: dJ90A20A.1
UniProtKB ID: Q86T65, G5EA45, Q5T4T8, Q5T4U0, Q9NQI5, Q9Y4G0
Gene ID:
Mouse(76441) dishevelled associated activator of morphogenesis 2
Rat(316201) dishevelled associated activator of morphogenesis 2
Zebrafish(798465) dishevelled associated activator of morphogenesis 2
dog(481783) dishevelled associated activator of morphogenesis 2
chicken(421422) dishevelled associated activator of morphogenesis 2
domestic cat(101086145) dishevelled associated activator of morphogenesis 2
cow(783665) dishevelled associated activator of morphogenesis 2
Horse(100054194) dishevelled associated activator of morphogenesis 2
sheep(101103274) dishevelled associated activator of morphogenesis 2
Domestic Rabbit(100347243) dishevelled associated activator of morphogenesis 2
naked mole-rat(101724412) dishevelled associated activator of morphogenesis 2
domestic guinea pig(100719618) dishevelled associated activator of morphogenesis 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015345 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015345 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015345 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001008231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001008231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001008231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU083241 MISSION® esiRNA esiRNA targeting mouse Daam2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015345 Rosetta Predictions human pricing
XM_001062791 Rosetta Predictions rat pricing
XM_236909 Rosetta Predictions rat pricing
NM_001008231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015345 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136207 predicted 1068
2 SASI_Hs01_00136208 predicted 610
3 SASI_Hs01_00136209 predicted 1066
4 SASI_Hs01_00136211 predicted 717
5 SASI_Hs01_00136212 predicted 3361
6 SASI_Hs01_00136213 predicted 984
7 SASI_Hs01_00136214 predicted 2758
8 SASI_Hs01_00136216 predicted 1553
9 SASI_Hs02_00347651 predicted 2230
10 SASI_Hs02_00347652 predicted 701
11 SASI_Hs01_00136210 predicted 1100
12 SASI_Hs01_00136215 predicted 2350
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00304615 predicted 3012
2 SASI_Rn02_00304616 predicted 2196
3 SASI_Rn02_00304617 predicted 1943
4 SASI_Rn02_00304618 predicted 2673
5 SASI_Rn02_00304619 predicted 938
6 SASI_Rn02_00304620 predicted 1143
7 SASI_Rn02_00304621 predicted 3134
8 SASI_Rn02_00304622 predicted 794
9 SASI_Rn02_00304623 predicted 1570
10 SASI_Rn02_00304624 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236909 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390474 predicted 3084
2 SASI_Rn02_00390475 predicted 2749
3 SASI_Rn02_00390476 predicted 940
4 SASI_Rn02_00390477 predicted 2904
5 SASI_Rn02_00390478 predicted 1145
6 SASI_Rn02_00390479 predicted 3224
7 SASI_Rn02_00390480 predicted 3208
8 SASI_Rn02_00390481 predicted 2745
9 SASI_Rn02_00390482 predicted 803
10 SASI_Rn02_00390483 predicted 341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155558 predicted 598
2 SASI_Mm02_00286769 predicted 2925
3 SASI_Mm01_00155559 predicted 2803
4 SASI_Mm02_00286770 predicted 2839
5 SASI_Mm01_00155561 predicted 1478
6 SASI_Mm01_00155562 predicted 2312
7 SASI_Mm02_00286771 predicted 3511
8 SASI_Mm01_00155563 predicted 3087
9 SASI_Mm01_00155564 predicted 3294
10 SASI_Mm01_00155565 predicted 2039
11 SASI_Mm01_00155557 predicted 756
12 SASI_Mm01_00155560 predicted 996
13 SASI_Mm01_00155566 predicted 2542
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015345
VALIDATED
DAAM2 MISSION shRNA Bacterial Glycerol Stock
dishevelled associated activator of morphogenesis 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-520s21c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-1147s21c1
Sequence:CCGGGCCATCCTGGACAAACATTTACTCGAGTAAATGTTTGTCCAGGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-641s21c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-2715s21c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-3361s21c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-520s1c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015345.2-2715s1c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015345.2-654s1c1
Sequence:CCGGGCTAAATTTCCTCCGGAGCATCTCGAGATGCTCCGGAGGAAATTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-775s1c1
Sequence:CCGGCCTGAGGCCATTAGTACCATACTCGAGTATGGTACTAATGGCCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-3361s1c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-4858s1c1
Sequence:CCGGGCTCTTATTCAATACCACGTTCTCGAGAACGTGGTATTGAATAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-641s1c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015345.2-5765s1c1
Sequence:CCGGGCTGGTCCTTAATAGGTTGTTCTCGAGAACAACCTATTAAGGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015345
VALIDATED
DAAM2 MISSION shRNA shRNA Plasmid DNA
dishevelled associated activator of morphogenesis 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-520s21c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-1147s21c1
Sequence:CCGGGCCATCCTGGACAAACATTTACTCGAGTAAATGTTTGTCCAGGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-641s21c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-2715s21c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-3361s21c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-520s1c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015345.2-2715s1c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015345.2-654s1c1
Sequence:CCGGGCTAAATTTCCTCCGGAGCATCTCGAGATGCTCCGGAGGAAATTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-775s1c1
Sequence:CCGGCCTGAGGCCATTAGTACCATACTCGAGTATGGTACTAATGGCCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-3361s1c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-4858s1c1
Sequence:CCGGGCTCTTATTCAATACCACGTTCTCGAGAACGTGGTATTGAATAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-641s1c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015345.2-5765s1c1
Sequence:CCGGGCTGGTCCTTAATAGGTTGTTCTCGAGAACAACCTATTAAGGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015345
VALIDATED
DAAM2 MISSION shRNA Lentiviral Transduction Particles
dishevelled associated activator of morphogenesis 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-520s21c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-1147s21c1
Sequence:CCGGGCCATCCTGGACAAACATTTACTCGAGTAAATGTTTGTCCAGGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-641s21c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-2715s21c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015345.2-3361s21c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-520s1c1
Sequence:CCGGCAGAGTCTGTACGCGTTTGATCTCGAGATCAAACGCGTACAGACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015345.2-2715s1c1
Sequence:CCGGCCTGATCATGATCCTGGAGAACTCGAGTTCTCCAGGATCATGATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015345.2-654s1c1
Sequence:CCGGGCTAAATTTCCTCCGGAGCATCTCGAGATGCTCCGGAGGAAATTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-775s1c1
Sequence:CCGGCCTGAGGCCATTAGTACCATACTCGAGTATGGTACTAATGGCCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-3361s1c1
Sequence:CCGGCGGGCAATAAACCGGCTAAATCTCGAGATTTAGCCGGTTTATTGCCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151161    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015345.2-4858s1c1
Sequence:CCGGGCTCTTATTCAATACCACGTTCTCGAGAACGTGGTATTGAATAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152691    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015345.2-641s1c1
Sequence:CCGGGCTTGACCTGTCTGCTAAATTCTCGAGAATTTAGCAGACAGGTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153125    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015345.2-5765s1c1
Sequence:CCGGGCTGGTCCTTAATAGGTTGTTCTCGAGAACAACCTATTAAGGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008231
DAAM2 MISSION shRNA Bacterial Glycerol Stock
dishevelled associated activator of morphogenesis 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-1748s1c1
Sequence:CCGGCCCGACATAATGAGAGCTCAACTCGAGTTGAGCTCTCATTATGTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2398s1c1
Sequence:CCGGGCCCAGAACTGTATCATTCTTCTCGAGAAGAATGATACAGTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-680s1c1
Sequence:CCGGGCCTGACCTGTCTGTTGAATTCTCGAGAATTCAACAGACAGGTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-592s1c1
Sequence:CCGGGACAAGAGGAACCAAGTTGTACTCGAGTACAACTTGGTTCCTCTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2945s1c1
Sequence:CCGGCCTCAGAGCTAAAGCACCTATCTCGAGATAGGTGCTTTAGCTCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008231
DAAM2 MISSION shRNA shRNA Plasmid DNA
dishevelled associated activator of morphogenesis 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-1748s1c1
Sequence:CCGGCCCGACATAATGAGAGCTCAACTCGAGTTGAGCTCTCATTATGTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2398s1c1
Sequence:CCGGGCCCAGAACTGTATCATTCTTCTCGAGAAGAATGATACAGTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-680s1c1
Sequence:CCGGGCCTGACCTGTCTGTTGAATTCTCGAGAATTCAACAGACAGGTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-592s1c1
Sequence:CCGGGACAAGAGGAACCAAGTTGTACTCGAGTACAACTTGGTTCCTCTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2945s1c1
Sequence:CCGGCCTCAGAGCTAAAGCACCTATCTCGAGATAGGTGCTTTAGCTCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008231
DAAM2 MISSION shRNA Lentiviral Transduction Particles
dishevelled associated activator of morphogenesis 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-1748s1c1
Sequence:CCGGCCCGACATAATGAGAGCTCAACTCGAGTTGAGCTCTCATTATGTCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2398s1c1
Sequence:CCGGGCCCAGAACTGTATCATTCTTCTCGAGAAGAATGATACAGTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-680s1c1
Sequence:CCGGGCCTGACCTGTCTGTTGAATTCTCGAGAATTCAACAGACAGGTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-592s1c1
Sequence:CCGGGACAAGAGGAACCAAGTTGTACTCGAGTACAACTTGGTTCCTCTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001008231.1-2945s1c1
Sequence:CCGGCCTCAGAGCTAAAGCACCTATCTCGAGATAGGTGCTTTAGCTCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)