EMAIL THIS PAGE TO A FRIEND

DAB1

Dab, reelin signal transducer, homolog 1 (Drosophila)

73 Gene Product Result for
Gene ID:
Human(1600) Summary: The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(13131) disabled 1
Rat(266729) Dab, reelin signal transducer, homolog 1 (Drosophila)
chicken(374083) disabled homolog 1 (Drosophila)
cow(538818) Dab, reelin signal transducer, homolog 1 (Drosophila)
Horse(100049825) disabled homolog 1 (Drosophila)
domestic cat(101099483) disabled homolog 1 (Drosophila)
dog(610344) disabled homolog 1 (Drosophila)
domestic guinea pig(100729327) Dab, reelin signal transducer, homolog 1 (Drosophila)
naked mole-rat(101725273) Dab, reelin signal transducer, homolog 1 (Drosophila)
sheep(101102768) disabled homolog 1 (Drosophila)
Domestic Rabbit(100337993) disabled homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D1569 Anti-Dab-1 (C-terminal) from rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
western blot pricing
SAB4300505 Anti-DAB1 (Ab-232) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry pricing
SAB1405694 Anti-DAB1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA052033 Anti-DAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2105836 Anti-DAB1 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, horse, human
western blot pricing
SAB4503448 Anti-DAB1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
SAB4503449 Anti-DAB1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, western blot pricing
HPA067495 Anti-DAB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4504376 Anti-phospho-Dab1 (pTyr220) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry pricing
SAB4504377 Anti-phospho-Dab1 (pTyr232) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021080 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021080 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021080 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030001 MISSION® esiRNA esiRNA human DAB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021080 Rosetta Predictions human pricing
NM_153621 Rosetta Predictions rat pricing
NM_010014 Rosetta Predictions mouse pricing
NM_177259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021080 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093248 predicted 848
2 SASI_Hs01_00093249 predicted 1257
3 SASI_Hs01_00093251 predicted 750
4 SASI_Hs01_00093252 predicted 1114
5 SASI_Hs01_00093253 predicted 797
6 SASI_Hs02_00354570 predicted 1159
7 SASI_Hs01_00093254 predicted 1124
8 SASI_Hs01_00093255 predicted 1908
9 SASI_Hs01_00093257 predicted 1017
10 SASI_Hs02_00354571 predicted 1904
11 SASI_Hs01_00093250 predicted 1775
12 SASI_Hs01_00093256 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268991 predicted 844
2 SASI_Rn01_00101674 predicted 401
3 SASI_Rn01_00101675 predicted 462
4 SASI_Rn02_00268992 predicted 524
5 SASI_Rn01_00101676 predicted 1177
6 SASI_Rn01_00101677 predicted 1198
7 SASI_Rn01_00101678 predicted 687
8 SASI_Rn01_00101679 predicted 273
9 SASI_Rn01_00101681 predicted 487
10 SASI_Rn01_00101682 predicted 1230
11 SASI_Rn01_00101680 predicted 1382
12 SASI_Rn01_00101683 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035228 predicted 409
2 SASI_Mm01_00035231 predicted 471
3 SASI_Mm01_00035232 predicted 422
4 SASI_Mm01_00035233 predicted 366
5 SASI_Mm01_00035234 predicted 651
6 SASI_Mm01_00035235 predicted 381
7 SASI_Mm01_00035236 predicted 295
8 SASI_Mm01_00035237 predicted 370
9 SASI_Mm02_00317618 predicted 605
10 SASI_Mm02_00317619 predicted 305
11 SASI_Mm01_00035229 predicted 622
12 SASI_Mm01_00035230 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347293 predicted 721
2 SASI_Mm02_00347294 predicted 1913
3 SASI_Mm02_00347295 predicted 1451
4 SASI_Mm01_00127170 predicted 461
5 SASI_Mm02_00347296 predicted 1789
6 SASI_Mm01_00127173 predicted 636
7 SASI_Mm01_00127174 predicted 363
8 SASI_Mm02_00347297 predicted 776
9 SASI_Mm01_00127175 predicted 291
10 SASI_Mm02_00347298 predicted 290
11 SASI_Mm01_00127167 predicted 403
12 SASI_Mm01_00127168 predicted 609
13 SASI_Mm01_00127169 predicted 321
14 SASI_Mm01_00127171 predicted 413
15 SASI_Mm01_00127172 predicted 359
16 SASI_Mm01_00127176 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010014
DAB1 MISSION shRNA Bacterial Glycerol Stock
Dab, reelin signal transducer, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-573s1c1
Sequence:CCGGCTTCAGCATCACCATGCTGTTCTCGAGAACAGCATGGTGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-846s1c1
Sequence:CCGGGATCCCGTGTACCAGGTAATTCTCGAGAATTACCTGGTACACGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-348s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-797s1c1
Sequence:CCGGGCAGTGTGAACAAGCTGTGTACTCGAGTACACAGCTTGTTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-440s1c1
Sequence:CCGGGTTATGTCAAGATTCCATGATCTCGAGATCATGGAATCTTGACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-946s1c1
Sequence:CCGGCTGCAGAAGAATTAAGATGATCTCGAGATCATCTTAATTCTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-940s1c1
Sequence:CCGGCAGAACCTGCAGAAGAATTAACTCGAGTTAATTCTTCTGCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-729s1c1
Sequence:CCGGGATCTCTTTCAACTCATCTATCTCGAGATAGATGAGTTGAAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010014.2-971s1c1
Sequence:CCGGAGAACCTGCAGAAGAATTAAGCTCGAGCTTAATTCTTCTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010014
DAB1 MISSION shRNA shRNA Plasmid DNA
Dab, reelin signal transducer, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-573s1c1
Sequence:CCGGCTTCAGCATCACCATGCTGTTCTCGAGAACAGCATGGTGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-846s1c1
Sequence:CCGGGATCCCGTGTACCAGGTAATTCTCGAGAATTACCTGGTACACGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-348s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-797s1c1
Sequence:CCGGGCAGTGTGAACAAGCTGTGTACTCGAGTACACAGCTTGTTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-440s1c1
Sequence:CCGGGTTATGTCAAGATTCCATGATCTCGAGATCATGGAATCTTGACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-946s1c1
Sequence:CCGGCTGCAGAAGAATTAAGATGATCTCGAGATCATCTTAATTCTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-940s1c1
Sequence:CCGGCAGAACCTGCAGAAGAATTAACTCGAGTTAATTCTTCTGCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-729s1c1
Sequence:CCGGGATCTCTTTCAACTCATCTATCTCGAGATAGATGAGTTGAAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010014.2-971s1c1
Sequence:CCGGAGAACCTGCAGAAGAATTAAGCTCGAGCTTAATTCTTCTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010014
DAB1 MISSION shRNA Lentiviral Transduction Particles
Dab, reelin signal transducer, homolog 1 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182772    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-573s1c1
Sequence:CCGGCTTCAGCATCACCATGCTGTTCTCGAGAACAGCATGGTGATGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-846s1c1
Sequence:CCGGGATCCCGTGTACCAGGTAATTCTCGAGAATTACCTGGTACACGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-348s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-797s1c1
Sequence:CCGGGCAGTGTGAACAAGCTGTGTACTCGAGTACACAGCTTGTTCACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010014.1-440s1c1
Sequence:CCGGGTTATGTCAAGATTCCATGATCTCGAGATCATGGAATCTTGACATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176715    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-946s1c1
Sequence:CCGGCTGCAGAAGAATTAAGATGATCTCGAGATCATCTTAATTCTTCTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010014.1-940s1c1
Sequence:CCGGCAGAACCTGCAGAAGAATTAACTCGAGTTAATTCTTCTGCAGGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_010014.1-729s1c1
Sequence:CCGGGATCTCTTTCAACTCATCTATCTCGAGATAGATGAGTTGAAAGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_010014.2-971s1c1
Sequence:CCGGAGAACCTGCAGAAGAATTAAGCTCGAGCTTAATTCTTCTGCAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021080
DAB1 MISSION shRNA Bacterial Glycerol Stock
Dab, reelin signal transducer, homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-804s1c1
Sequence:CCGGGCCAAATTGATCGGGATTGATCTCGAGATCAATCCCGATCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1516s1c1
Sequence:CCGGCGAGTGCAGATGTGTTTAGTTCTCGAGAACTAAACACATCTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-2264s1c1
Sequence:CCGGCTCATCCAACAGTGATCCATTCTCGAGAATGGATCACTGTTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-759s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1777s1c1
Sequence:CCGGCCACACAAACTGTTATGCCTTCTCGAGAAGGCATAACAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-1392s21c1
Sequence:CCGGGTAAGTGCTGTGACCCAATTACTCGAGTAATTGGGTCACAGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-2300s21c1
Sequence:CCGGGGAGCCCAGTGGTGATAATATCTCGAGATATTATCACCACTGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021080
DAB1 MISSION shRNA shRNA Plasmid DNA
Dab, reelin signal transducer, homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-804s1c1
Sequence:CCGGGCCAAATTGATCGGGATTGATCTCGAGATCAATCCCGATCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1516s1c1
Sequence:CCGGCGAGTGCAGATGTGTTTAGTTCTCGAGAACTAAACACATCTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-2264s1c1
Sequence:CCGGCTCATCCAACAGTGATCCATTCTCGAGAATGGATCACTGTTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-759s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1777s1c1
Sequence:CCGGCCACACAAACTGTTATGCCTTCTCGAGAAGGCATAACAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-1392s21c1
Sequence:CCGGGTAAGTGCTGTGACCCAATTACTCGAGTAATTGGGTCACAGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-2300s21c1
Sequence:CCGGGGAGCCCAGTGGTGATAATATCTCGAGATATTATCACCACTGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021080
DAB1 MISSION shRNA Lentiviral Transduction Particles
Dab, reelin signal transducer, homolog 1 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-804s1c1
Sequence:CCGGGCCAAATTGATCGGGATTGATCTCGAGATCAATCCCGATCAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1516s1c1
Sequence:CCGGCGAGTGCAGATGTGTTTAGTTCTCGAGAACTAAACACATCTGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-2264s1c1
Sequence:CCGGCTCATCCAACAGTGATCCATTCTCGAGAATGGATCACTGTTGGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-759s1c1
Sequence:CCGGGCCACTTTGATAAAGAGGTTTCTCGAGAAACCTCTTTATCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021080.3-1777s1c1
Sequence:CCGGCCACACAAACTGTTATGCCTTCTCGAGAAGGCATAACAGTTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435003    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-1392s21c1
Sequence:CCGGGTAAGTGCTGTGACCCAATTACTCGAGTAATTGGGTCACAGCACTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021080.3-2300s21c1
Sequence:CCGGGGAGCCCAGTGGTGATAATATCTCGAGATATTATCACCACTGGGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks