EMAIL THIS PAGE TO A FRIEND

DAB2

Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)

109 Gene Product Result for
Synonyms: DOC-2 DOC2
UniProtKB ID: P98082, A6NES5, Q13598, Q9BTY0, Q9UK04
Gene ID:
Human(1601) Summary: This gene encodes a mitogen-responsive phosphoprotein. It is expressed in normal ovarian epithelial cells, but is down-regulated or absent from ovarian carcinoma cell lines, suggesting its role as a tumor suppressor. This protein binds to the SH3 domains of GRB2, an adaptor protein that couples tyrosine kinase receptors to SOS (a guanine nucleotide exchange factor for Ras), via its C-terminal proline-rich sequences, and may thus modulate growth factor/Ras pathways by competing with SOS for binding to GRB2. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(13132) disabled 2, mitogen-responsive phosphoprotein
Rat(79128) disabled 2, mitogen-responsive phosphoprotein
Zebrafish(404040) disabled homolog 2 (Drosophila)
domestic cat(101096539) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
cow(509221) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
Horse(100066655) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
dog(479353) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
chicken(427449) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
sheep(101104604) disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)
naked mole-rat(101725399) Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
domestic guinea pig(100734816) Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001343 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001343 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001343 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023118 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023118 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023118 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001343 Rosetta Predictions human pricing
NM_024159 Rosetta Predictions rat pricing
NM_001008702 Rosetta Predictions mouse pricing
NM_001037905 Rosetta Predictions mouse pricing
NM_001102400 Rosetta Predictions mouse pricing
NM_023118 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001343 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161135 predicted 2619
2 SASI_Hs01_00161136 predicted 2538
3 SASI_Hs01_00161137 predicted 2483
4 SASI_Hs01_00161139 predicted 2704
5 SASI_Hs01_00161140 predicted 2644
6 SASI_Hs01_00161141 predicted 1761
7 SASI_Hs01_00161142 predicted 1863
8 SASI_Hs01_00161143 predicted 2941
9 SASI_Hs01_00161144 predicted 1439
10 SASI_Hs02_00331663 predicted 2635
11 SASI_Hs01_00161138 predicted 2341
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024159 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108824 predicted 292
2 SASI_Rn01_00108825 predicted 978
3 SASI_Rn01_00108828 predicted 1706
4 SASI_Rn01_00108829 predicted 1021
5 SASI_Rn01_00108830 predicted 1877
6 SASI_Rn01_00108831 predicted 216
7 SASI_Rn01_00108832 predicted 946
8 SASI_Rn01_00108833 predicted 1231
9 SASI_Rn02_00263894 predicted 2304
10 SASI_Rn02_00263895 predicted 2186
11 SASI_Rn01_00108826 predicted 2120
12 SASI_Rn01_00108827 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286836 predicted 1654
2 SASI_Mm02_00286837 predicted 1660
3 SASI_Mm01_00054569 predicted 1421
4 SASI_Mm02_00286838 predicted 1851
5 SASI_Mm01_00054570 predicted 1196
6 SASI_Mm01_00054571 predicted 1185
7 SASI_Mm02_00286839 predicted 372
8 SASI_Mm02_00286840 predicted 361
9 SASI_Mm01_00054574 predicted 413
10 SASI_Mm02_00286841 predicted 330
11 SASI_Mm01_00054566 predicted 2013
12 SASI_Mm01_00054567 predicted 2003
13 SASI_Mm01_00054568 predicted 1969
14 SASI_Mm01_00054572 predicted 542
15 SASI_Mm01_00054573 predicted 1902
16 SASI_Mm01_00054575 predicted 2040
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289482 predicted 1699
2 SASI_Mm02_00289483 predicted 1729
3 SASI_Mm02_00289484 predicted 1737
4 SASI_Mm02_00289485 predicted 1488
5 SASI_Mm02_00289486 predicted 1929
6 SASI_Mm01_00111572 predicted 1269
7 SASI_Mm01_00111573 predicted 1263
8 SASI_Mm02_00289487 predicted 446
9 SASI_Mm02_00289488 predicted 437
10 SASI_Mm01_00111576 predicted 493
11 SASI_Mm01_00111570 predicted 2117
12 SASI_Mm01_00111571 predicted 2367
13 SASI_Mm01_00111574 predicted 2016
14 SASI_Mm01_00111575 predicted 2267
15 SASI_Mm01_00111577 predicted 2146
16 SASI_Mm01_00111578 predicted 2328
17 SASI_Mm01_00111579 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302674 predicted 1641
2 SASI_Mm02_00302675 predicted 1670
3 SASI_Mm02_00302676 predicted 1675
4 SASI_Mm02_00302677 predicted 1431
5 SASI_Mm02_00302678 predicted 1863
6 SASI_Mm02_00302679 predicted 1213
7 SASI_Mm02_00302680 predicted 1193
8 SASI_Mm02_00302681 predicted 439
9 SASI_Mm02_00302682 predicted 432
10 SASI_Mm02_00302683 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023118 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326803 predicted 2358
2 SASI_Mm02_00326804 predicted 2378
3 SASI_Mm02_00326805 predicted 2392
4 SASI_Mm01_00122626 predicted 2142
5 SASI_Mm02_00326806 predicted 2582
6 SASI_Mm01_00122627 predicted 1927
7 SASI_Mm01_00122628 predicted 1910
8 SASI_Mm02_00326807 predicted 445
9 SASI_Mm02_00326808 predicted 435
10 SASI_Mm01_00122631 predicted 490
11 SASI_Mm01_00122623 predicted 2785
12 SASI_Mm01_00122624 predicted 2771
13 SASI_Mm01_00122625 predicted 2747
14 SASI_Mm01_00122629 predicted 656
15 SASI_Mm01_00122630 predicted 2684
16 SASI_Mm01_00122632 predicted 2812
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001343
DAB2 MISSION shRNA Bacterial Glycerol Stock
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-868s21c1
Sequence:GTACCGGGAGCATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2806s21c1
Sequence:GTACCGGGAGATGTATAGGGATCCATTTCTCGAGAAATGGATCCCTATACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2567s21c1
Sequence:GTACCGGTGAGTGCCTTTGCCAGTTATTCTCGAGAATAACTGGCAAAGGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001343.2-2945s21c1
Sequence:GTACCGGGTTCCAGCTTTGACGTATTATCTCGAGATAATACGTCAAAGCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-1749s21c1
Sequence:GTACCGGGTCCATACAGAATGGCGTAAACTCGAGTTTACGCCATTCTGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1883s1c1
Sequence:CCGGCACCCAATGCTTGGTCAACAACTCGAGTTGTTGACCAAGCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1469s1c1
Sequence:CCGGGCAGAAGGACTGCTAAGTCTTCTCGAGAAGACTTAGCAGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2392s1c1
Sequence:CCGGGTGGCTTCTTCTCAACCTGTACTCGAGTACAGGTTGAGAAGAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2160s1c1
Sequence:CCGGGCAGACTTCTTCTGGGACTTTCTCGAGAAAGTCCCAGAAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2233s1c1
Sequence:CCGGGCAGACCATGATGACTTTGATCTCGAGATCAAAGTCATCATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001343
DAB2 MISSION shRNA shRNA Plasmid DNA
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-868s21c1
Sequence:GTACCGGGAGCATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2806s21c1
Sequence:GTACCGGGAGATGTATAGGGATCCATTTCTCGAGAAATGGATCCCTATACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2567s21c1
Sequence:GTACCGGTGAGTGCCTTTGCCAGTTATTCTCGAGAATAACTGGCAAAGGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001343.2-2945s21c1
Sequence:GTACCGGGTTCCAGCTTTGACGTATTATCTCGAGATAATACGTCAAAGCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-1749s21c1
Sequence:GTACCGGGTCCATACAGAATGGCGTAAACTCGAGTTTACGCCATTCTGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1883s1c1
Sequence:CCGGCACCCAATGCTTGGTCAACAACTCGAGTTGTTGACCAAGCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1469s1c1
Sequence:CCGGGCAGAAGGACTGCTAAGTCTTCTCGAGAAGACTTAGCAGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2392s1c1
Sequence:CCGGGTGGCTTCTTCTCAACCTGTACTCGAGTACAGGTTGAGAAGAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2160s1c1
Sequence:CCGGGCAGACTTCTTCTGGGACTTTCTCGAGAAAGTCCCAGAAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2233s1c1
Sequence:CCGGGCAGACCATGATGACTTTGATCTCGAGATCAAAGTCATCATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001343
DAB2 MISSION shRNA Lentiviral Transduction Particles
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-868s21c1
Sequence:GTACCGGGAGCATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2806s21c1
Sequence:GTACCGGGAGATGTATAGGGATCCATTTCTCGAGAAATGGATCCCTATACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-2567s21c1
Sequence:GTACCGGTGAGTGCCTTTGCCAGTTATTCTCGAGAATAACTGGCAAAGGCACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001343.2-2945s21c1
Sequence:GTACCGGGTTCCAGCTTTGACGTATTATCTCGAGATAATACGTCAAAGCTGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001343.2-1749s21c1
Sequence:GTACCGGGTCCATACAGAATGGCGTAAACTCGAGTTTACGCCATTCTGTATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1883s1c1
Sequence:CCGGCACCCAATGCTTGGTCAACAACTCGAGTTGTTGACCAAGCATTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-1469s1c1
Sequence:CCGGGCAGAAGGACTGCTAAGTCTTCTCGAGAAGACTTAGCAGTCCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2392s1c1
Sequence:CCGGGTGGCTTCTTCTCAACCTGTACTCGAGTACAGGTTGAGAAGAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2160s1c1
Sequence:CCGGGCAGACTTCTTCTGGGACTTTCTCGAGAAAGTCCCAGAAGAAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001343.1-2233s1c1
Sequence:CCGGGCAGACCATGATGACTTTGATCTCGAGATCAAAGTCATCATGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023118
VALIDATED
DAB2 MISSION shRNA Bacterial Glycerol Stock
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-701s21c1
Sequence:GTACCGGGGTGAAGGCCAGCATCAATTTCTCGAGAAATTGATGCTGGCCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-1293s21c1
Sequence:GTACCGGACGGTGATACTGATTACTTTGCTCGAGCAAAGTAATCAGTATCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-879s21c1
Sequence:GTACCGGTTGATGATCAAGCTAACAAATCTCGAGATTTGTTAGCTTGATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-1848s21c1
Sequence:CCGGTGGTCCCAGGAGCCATAATAACTCGAGTTATTATGGCTCCTGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-620s21c1
Sequence:CCGGGAACATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-752s21c1
Sequence:CCGGCCATTAGTCGTCGATCTTAAACTCGAGTTTAAGATCGACGACTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2780s21c1
Sequence:CCGGACTATGGCTTTACGTAAATTACTCGAGTAATTTACGTAAAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2323s21c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2679s21c1
Sequence:GTACCGGTCGCTCCAGCTTTGACGTATTCTCGAGAATACGTCAAAGCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023118.1-1841s1c1
Sequence:CCGGCCAGCAGTACAAGTCTGGAATCTCGAGATTCCAGACTTGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-791s1c1
Sequence:CCGGGCCCTAATGACCCTTGATGATCTCGAGATCATCAAGGGTCATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2248s1c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2794s1c1
Sequence:CCGGCCCTTGAAACTTCCAGAATATCTCGAGATATTCTGGAAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023118
VALIDATED
DAB2 MISSION shRNA shRNA Plasmid DNA
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-701s21c1
Sequence:GTACCGGGGTGAAGGCCAGCATCAATTTCTCGAGAAATTGATGCTGGCCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-1293s21c1
Sequence:GTACCGGACGGTGATACTGATTACTTTGCTCGAGCAAAGTAATCAGTATCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-879s21c1
Sequence:GTACCGGTTGATGATCAAGCTAACAAATCTCGAGATTTGTTAGCTTGATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-1848s21c1
Sequence:CCGGTGGTCCCAGGAGCCATAATAACTCGAGTTATTATGGCTCCTGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-620s21c1
Sequence:CCGGGAACATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-752s21c1
Sequence:CCGGCCATTAGTCGTCGATCTTAAACTCGAGTTTAAGATCGACGACTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2780s21c1
Sequence:CCGGACTATGGCTTTACGTAAATTACTCGAGTAATTTACGTAAAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2323s21c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2679s21c1
Sequence:GTACCGGTCGCTCCAGCTTTGACGTATTCTCGAGAATACGTCAAAGCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023118.1-1841s1c1
Sequence:CCGGCCAGCAGTACAAGTCTGGAATCTCGAGATTCCAGACTTGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-791s1c1
Sequence:CCGGGCCCTAATGACCCTTGATGATCTCGAGATCATCAAGGGTCATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2248s1c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2794s1c1
Sequence:CCGGCCCTTGAAACTTCCAGAATATCTCGAGATATTCTGGAAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023118
VALIDATED
DAB2 MISSION shRNA Lentiviral Transduction Particles
Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-701s21c1
Sequence:GTACCGGGGTGAAGGCCAGCATCAATTTCTCGAGAAATTGATGCTGGCCTTCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-1293s21c1
Sequence:GTACCGGACGGTGATACTGATTACTTTGCTCGAGCAAAGTAATCAGTATCACCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-879s21c1
Sequence:GTACCGGTTGATGATCAAGCTAACAAATCTCGAGATTTGTTAGCTTGATCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-1848s21c1
Sequence:CCGGTGGTCCCAGGAGCCATAATAACTCGAGTTATTATGGCTCCTGGGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023118.5-620s21c1
Sequence:CCGGGAACATGAACATCCAGTAAATCTCGAGATTTACTGGATGTTCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-752s21c1
Sequence:CCGGCCATTAGTCGTCGATCTTAAACTCGAGTTTAAGATCGACGACTAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337794    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2780s21c1
Sequence:CCGGACTATGGCTTTACGTAAATTACTCGAGTAATTTACGTAAAGCCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2323s21c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023118.5-2679s21c1
Sequence:GTACCGGTCGCTCCAGCTTTGACGTATTCTCGAGAATACGTCAAAGCTGGAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023118.1-1841s1c1
Sequence:CCGGCCAGCAGTACAAGTCTGGAATCTCGAGATTCCAGACTTGTACTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-791s1c1
Sequence:CCGGGCCCTAATGACCCTTGATGATCTCGAGATCATCAAGGGTCATTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2248s1c1
Sequence:CCGGCTCCAGTTACTTCAACAATAACTCGAGTTATTGTTGAAGTAACTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023118.1-2794s1c1
Sequence:CCGGCCCTTGAAACTTCCAGAATATCTCGAGATATTCTGGAAGTTTCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks