EMAIL THIS PAGE TO A FRIEND

DAB2IP

DAB2 interacting protein

138 Gene Product Result for
Synonyms: AF9Q34 AIP-1 AIP1 DIP1/2
Gene ID:
Human(153090) Summary: DAB2IP is a Ras (MIM 190020) GTPase-activating protein (GAP) that acts as a tumor suppressor. The DAB2IP gene is inactivated by methylation in prostate and breast cancers (Yano et al., 2005 [PubMed 15386433]
Mouse(69601) disabled 2 interacting protein
Rat(192126) DAB2 interacting protein
domestic guinea pig(100719421) DAB2 interacting protein
naked mole-rat(101703969) DAB2 interacting protein
sheep(101122097) DAB2 interacting protein
chicken(417117) DAB2 interacting protein
cow(541268) DAB2 interacting protein
Horse(100071680) DAB2 interacting protein
dog(491356) DAB2 interacting protein
domestic cat(101091160) DAB2 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032552 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032552 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032552 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_130206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_130206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_130206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001114125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001114125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032552 Rosetta Predictions human pricing
NM_138709 Rosetta Predictions human pricing
NM_138710 Rosetta Predictions rat pricing
NM_001001602 Rosetta Predictions mouse pricing
NM_001114124 Rosetta Predictions mouse pricing
NM_001114125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032552 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174519 predicted 1238
2 SASI_Hs01_00174520 predicted 1130
3 SASI_Hs01_00174521 predicted 1309
4 SASI_Hs01_00174522 predicted 968
5 SASI_Hs01_00174523 predicted 1436
6 SASI_Hs01_00174524 predicted 611
7 SASI_Hs01_00174525 predicted 1687
8 SASI_Hs01_00174526 predicted 797
9 SASI_Hs01_00174527 predicted 2175
10 SASI_Hs01_00174528 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188101 predicted 1035
2 SASI_Hs01_00188102 predicted 919
3 SASI_Hs01_00188103 predicted 1097
4 SASI_Hs01_00188104 predicted 758
5 SASI_Hs01_00188105 predicted 1224
6 SASI_Hs01_00188106 predicted 399
7 SASI_Hs01_00188107 predicted 1470
8 SASI_Hs01_00188108 predicted 588
9 SASI_Hs01_00188109 predicted 1967
10 SASI_Hs01_00188110 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268193 predicted 681
2 SASI_Rn01_00085285 predicted 3678
3 SASI_Rn02_00268194 predicted 528
4 SASI_Rn02_00268195 predicted 663
5 SASI_Rn02_00268196 predicted 632
6 SASI_Rn02_00268197 predicted 736
7 SASI_Rn01_00085286 predicted 2094
8 SASI_Rn01_00085287 predicted 3555
9 SASI_Rn01_00085288 predicted 3684
10 SASI_Rn01_00085289 predicted 3711
11 SASI_Rn01_00085290 predicted 1106
12 SASI_Rn01_00085291 predicted 3200
13 SASI_Rn01_00085292 predicted 1173
14 SASI_Rn01_00085293 predicted 1047
15 SASI_Rn01_00085294 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001602 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165624 predicted 3273
2 SASI_Mm01_00165625 predicted 1744
3 SASI_Mm01_00165627 predicted 3073
4 SASI_Mm01_00165629 predicted 731
5 SASI_Mm01_00165630 predicted 1982
6 SASI_Mm02_00286187 predicted 1059
7 SASI_Mm02_00286188 predicted 3076
8 SASI_Mm01_00165631 predicted 1582
9 SASI_Mm01_00165633 predicted 3225
10 SASI_Mm02_00286189 predicted 1345
11 SASI_Mm01_00165626 predicted 3567
12 SASI_Mm01_00165628 predicted 1495
13 SASI_Mm01_00165632 predicted 3445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114124 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308419 predicted 3402
2 SASI_Mm02_00308420 predicted 1865
3 SASI_Mm02_00308421 predicted 3197
4 SASI_Mm02_00308422 predicted 855
5 SASI_Mm02_00308423 predicted 2107
6 SASI_Mm02_00308424 predicted 1189
7 SASI_Mm02_00308425 predicted 3193
8 SASI_Mm02_00308426 predicted 1703
9 SASI_Mm02_00308427 predicted 3345
10 SASI_Mm02_00308428 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308429 predicted 3253
2 SASI_Mm02_00308430 predicted 1721
3 SASI_Mm02_00308431 predicted 3045
4 SASI_Mm02_00308432 predicted 707
5 SASI_Mm02_00308433 predicted 1951
6 SASI_Mm02_00308434 predicted 1037
7 SASI_Mm02_00308435 predicted 3051
8 SASI_Mm02_00308436 predicted 1550
9 SASI_Mm02_00308437 predicted 3199
10 SASI_Mm02_00308438 predicted 1318
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032552
VALIDATED
DAB2IP MISSION shRNA Bacterial Glycerol Stock
DAB2 interacting protein
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000001457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032552.x-4289s1c1
Sequence:CCGGGTAATGTAACTATCTCACCTACTCGAGTAGGTGAGATAGTTACATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-776s1c1
Sequence:CCGGGCACATCACTAACCACTACCTCTCGAGAGGTAGTGGTTAGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-3099s1c1
Sequence:CCGGGACTCCAAACAGAAGATCATTCTCGAGAATGATCTTCTGTTTGGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1163s1c1
Sequence:CCGGCTGCAAGACTATCAACTCCTACTCGAGTAGGAGTTGATAGTCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1044s1c1
Sequence:CCGGGAGTTCATCAAAGCGCTGTATCTCGAGATACAGCGCTTTGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-496s21c1
Sequence:CCGGTTCGAGGTGACGACGTCATCACTCGAGTGATGACGTCGTCACCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1576s21c1
Sequence:CCGGATGTCGCCCTCACTCTTCAACCTCGAGGTTGAAGAGTGAGGGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032552.2-3523s21c1
Sequence:CCGGGTGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-725s21c1
Sequence:CCGGGCAAGCTCAAGACGGACAATGCTCGAGCATTGTCCGTCTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1875s21c1
Sequence:CCGGGCTGGAGCAGAGCATAGTATCCTCGAGGATACTATGCTCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-2051s21c1
Sequence:CCGGACGATCTTTCCGGTCTGATAGCTCGAGCTATCAGACCGGAAAGATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1004s21c1
Sequence:CCGGTGCCCATGGAGATGTACAAAGCTCGAGCTTTGTACATCTCCATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3061s21c1
Sequence:CCGGAGGGATAGGCTAAGGAGTAAGCTCGAGCTTACTCCTTAGCCTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1517s21c1
Sequence:CCGGACATCAGTGAGCGGCTCATCACTCGAGTGATGAGCCGCTCACTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3119s21c1
Sequence:CCGGTGCAGGACAAGCTGCGAATCTCTCGAGAGATTCGCAGCTTGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032552
VALIDATED
DAB2IP MISSION shRNA shRNA Plasmid DNA
DAB2 interacting protein
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000001457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032552.x-4289s1c1
Sequence:CCGGGTAATGTAACTATCTCACCTACTCGAGTAGGTGAGATAGTTACATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-776s1c1
Sequence:CCGGGCACATCACTAACCACTACCTCTCGAGAGGTAGTGGTTAGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-3099s1c1
Sequence:CCGGGACTCCAAACAGAAGATCATTCTCGAGAATGATCTTCTGTTTGGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1163s1c1
Sequence:CCGGCTGCAAGACTATCAACTCCTACTCGAGTAGGAGTTGATAGTCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1044s1c1
Sequence:CCGGGAGTTCATCAAAGCGCTGTATCTCGAGATACAGCGCTTTGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-496s21c1
Sequence:CCGGTTCGAGGTGACGACGTCATCACTCGAGTGATGACGTCGTCACCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1576s21c1
Sequence:CCGGATGTCGCCCTCACTCTTCAACCTCGAGGTTGAAGAGTGAGGGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032552.2-3523s21c1
Sequence:CCGGGTGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-725s21c1
Sequence:CCGGGCAAGCTCAAGACGGACAATGCTCGAGCATTGTCCGTCTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1875s21c1
Sequence:CCGGGCTGGAGCAGAGCATAGTATCCTCGAGGATACTATGCTCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-2051s21c1
Sequence:CCGGACGATCTTTCCGGTCTGATAGCTCGAGCTATCAGACCGGAAAGATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1004s21c1
Sequence:CCGGTGCCCATGGAGATGTACAAAGCTCGAGCTTTGTACATCTCCATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3061s21c1
Sequence:CCGGAGGGATAGGCTAAGGAGTAAGCTCGAGCTTACTCCTTAGCCTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1517s21c1
Sequence:CCGGACATCAGTGAGCGGCTCATCACTCGAGTGATGAGCCGCTCACTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3119s21c1
Sequence:CCGGTGCAGGACAAGCTGCGAATCTCTCGAGAGATTCGCAGCTTGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032552
VALIDATED
DAB2IP MISSION shRNA Lentiviral Transduction Particles
DAB2 interacting protein
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000001457    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_032552.x-4289s1c1
Sequence:CCGGGTAATGTAACTATCTCACCTACTCGAGTAGGTGAGATAGTTACATTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-776s1c1
Sequence:CCGGGCACATCACTAACCACTACCTCTCGAGAGGTAGTGGTTAGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-3099s1c1
Sequence:CCGGGACTCCAAACAGAAGATCATTCTCGAGAATGATCTTCTGTTTGGAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1163s1c1
Sequence:CCGGCTGCAAGACTATCAACTCCTACTCGAGTAGGAGTTGATAGTCTTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032552.x-1044s1c1
Sequence:CCGGGAGTTCATCAAAGCGCTGTATCTCGAGATACAGCGCTTTGATGAACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-496s21c1
Sequence:CCGGTTCGAGGTGACGACGTCATCACTCGAGTGATGACGTCGTCACCTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1576s21c1
Sequence:CCGGATGTCGCCCTCACTCTTCAACCTCGAGGTTGAAGAGTGAGGGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032552.2-3523s21c1
Sequence:CCGGGTGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-725s21c1
Sequence:CCGGGCAAGCTCAAGACGGACAATGCTCGAGCATTGTCCGTCTTGAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1875s21c1
Sequence:CCGGGCTGGAGCAGAGCATAGTATCCTCGAGGATACTATGCTCTGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-2051s21c1
Sequence:CCGGACGATCTTTCCGGTCTGATAGCTCGAGCTATCAGACCGGAAAGATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1004s21c1
Sequence:CCGGTGCCCATGGAGATGTACAAAGCTCGAGCTTTGTACATCTCCATGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3061s21c1
Sequence:CCGGAGGGATAGGCTAAGGAGTAAGCTCGAGCTTACTCCTTAGCCTATCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-1517s21c1
Sequence:CCGGACATCAGTGAGCGGCTCATCACTCGAGTGATGAGCCGCTCACTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032552.2-3119s21c1
Sequence:CCGGTGCAGGACAAGCTGCGAATCTCTCGAGAGATTCGCAGCTTGTCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_130206
VALIDATED
DAB2IP MISSION shRNA Bacterial Glycerol Stock
DAB2 interacting protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-714s1c1
Sequence:CCGGCGGCCAAGAAGAAGTATCTATCTCGAGATAGATACTTCTTCTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-1367s1c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3403s1c1
Sequence:CCGGAGCTGTAGATTCCAAACAGAACTCGAGTTCTGTTTGGAATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-554s1c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3164s1c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_130206
VALIDATED
DAB2IP MISSION shRNA shRNA Plasmid DNA
DAB2 interacting protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-714s1c1
Sequence:CCGGCGGCCAAGAAGAAGTATCTATCTCGAGATAGATACTTCTTCTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-1367s1c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3403s1c1
Sequence:CCGGAGCTGTAGATTCCAAACAGAACTCGAGTTCTGTTTGGAATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-554s1c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3164s1c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_130206
VALIDATED
DAB2IP MISSION shRNA Lentiviral Transduction Particles
DAB2 interacting protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-714s1c1
Sequence:CCGGCGGCCAAGAAGAAGTATCTATCTCGAGATAGATACTTCTTCTTGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-1367s1c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3403s1c1
Sequence:CCGGAGCTGTAGATTCCAAACAGAACTCGAGTTCTGTTTGGAATCTACAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:XM_130206.4-554s1c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_130206.4-3164s1c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114125
DAB2IP MISSION shRNA Bacterial Glycerol Stock
DAB2 interacting protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000321658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114125.1-3569s21c1
Sequence:CCGGGAGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-491s21c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-3158s21c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-1361s21c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114125
DAB2IP MISSION shRNA shRNA Plasmid DNA
DAB2 interacting protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000321658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114125.1-3569s21c1
Sequence:CCGGGAGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-491s21c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-3158s21c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-1361s21c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114125
DAB2IP MISSION shRNA Lentiviral Transduction Particles
DAB2 interacting protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000321658    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114125.1-3569s21c1
Sequence:CCGGGAGCGCACTGCATGGGAAATACTCGAGTATTTCCCATGCAGTGCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-491s21c1
Sequence:CCGGGAGGTGATTATCAAGCCCGTTCTCGAGAACGGGCTTGATAATCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-3158s21c1
Sequence:CCGGGCAGTGCTACAAGACAAGCTACTCGAGTAGCTTGTCTTGTAGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114125.1-1361s21c1
Sequence:CCGGGCTCTGTATGAGTCAGATGAACTCGAGTTCATCTGACTCATACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks