EMAIL THIS PAGE TO A FRIEND

DACH1

dachshund homolog 1 (Drosophila)

228 Gene Product Result for
Synonyms: DACH
Gene ID:
Human(1602) Summary: This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(13134) dachshund 1 (Drosophila)
chicken(373935) dachshund homolog 1 (Drosophila)
Horse(100065685) dachshund homolog 1 (Drosophila)
cow(537184) dachshund homolog 1 (Drosophila)
domestic cat(101084158) dachshund homolog 1 (Drosophila)
dog(485489) dachshund homolog 1 (Drosophila)
sheep(101121866) dachshund homolog 1 (Drosophila)
naked mole-rat(101720270) dachshund homolog 1 (Drosophila)
domestic guinea pig(100733070) dachshund homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004392 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004392 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004392 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004392 Rosetta Predictions human pricing
NM_080759 Rosetta Predictions human pricing
NM_080760 Rosetta Predictions human pricing
NM_001038610 Rosetta Predictions mouse pricing
NM_007826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004392 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205725 predicted 1808
2 SASI_Hs01_00205726 predicted 1742
3 SASI_Hs01_00205727 predicted 1060
4 SASI_Hs02_00337502 predicted 1431
5 SASI_Hs01_00205728 predicted 1197
6 SASI_Hs01_00205729 predicted 1393
7 SASI_Hs01_00205731 predicted 1542
8 SASI_Hs01_00205732 predicted 1434
9 SASI_Hs01_00205733 predicted 1355
10 SASI_Hs01_00205734 predicted 1757
11 SASI_Hs01_00205730 predicted 1945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079330 predicted 2415
2 SASI_Hs01_00079331 predicted 2342
3 SASI_Hs01_00079332 predicted 1063
4 SASI_Hs02_00362554 predicted 2036
5 SASI_Hs01_00079333 predicted 1197
6 SASI_Hs01_00079334 predicted 1994
7 SASI_Hs01_00079336 predicted 2142
8 SASI_Hs02_00362555 predicted 2022
9 SASI_Hs01_00079337 predicted 1863
10 SASI_Hs01_00079338 predicted 1356
11 SASI_Hs01_00079335 predicted 2550
12 SASI_Hs01_00079339 predicted 2361
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226075 predicted 1963
2 SASI_Hs01_00226076 predicted 1903
3 SASI_Hs01_00226077 predicted 1059
4 SASI_Hs01_00226078 predicted 1590
5 SASI_Hs01_00226079 predicted 1199
6 SASI_Hs01_00226080 predicted 1550
7 SASI_Hs01_00226082 predicted 1700
8 SASI_Hs02_00362556 predicted 1592
9 SASI_Hs01_00226083 predicted 1352
10 SASI_Hs01_00226084 predicted 1911
11 SASI_Hs01_00226081 predicted 2110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038610 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192868 predicted 1944
2 SASI_Mm01_00192869 predicted 983
3 SASI_Mm01_00192870 predicted 1905
4 SASI_Mm01_00192871 predicted 2716
5 SASI_Mm01_00192872 predicted 1900
6 SASI_Mm01_00192873 predicted 1925
7 SASI_Mm02_00289623 predicted 2138
8 SASI_Mm01_00192874 predicted 2784
9 SASI_Mm01_00192875 predicted 2776
10 SASI_Mm01_00192876 predicted 1826
11 SASI_Mm01_00192877 predicted 1675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040772 predicted 2104
2 SASI_Mm01_00040773 predicted 989
3 SASI_Mm01_00040774 predicted 2060
4 SASI_Mm01_00040775 predicted 2871
5 SASI_Mm01_00040776 predicted 2059
6 SASI_Mm01_00040777 predicted 2079
7 SASI_Mm02_00312555 predicted 2293
8 SASI_Mm01_00040778 predicted 2942
9 SASI_Mm01_00040779 predicted 2932
10 SASI_Mm01_00040780 predicted 1986
11 SASI_Mm01_00040781 predicted 1822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007826
DACH1 MISSION shRNA Bacterial Glycerol Stock
dachshund homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2362s21c1
Sequence:CCGGGACAGTCTCCGGGTCTTAAATCTCGAGATTTAAGACCCGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2069s21c1
Sequence:CCGGAGACTCTTCTCACTAACATACCTCGAGGTATGTTAGTGAGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2473s21c1
Sequence:CCGGACTACTGTCATGTACTGAATACTCGAGTATTCAGTACATGACAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-873s1c1
Sequence:CCGGCCCAGAGAACTCTCACATCATCTCGAGATGATGTGAGAGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1742s1c1
Sequence:CCGGGCATCGACAAACTTTCTCTAACTCGAGTTAGAGAAAGTTTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-801s1c1
Sequence:CCGGCCTCTACAATGACTGCACCAACTCGAGTTGGTGCAGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1731s1c1
Sequence:CCGGCGCAAGAGACAGCATCGACAACTCGAGTTGTCGATGCTGTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1035s1c1
Sequence:CCGGGAGCAACTATCATGCCAGTAACTCGAGTTACTGGCATGATAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007826
DACH1 MISSION shRNA shRNA Plasmid DNA
dachshund homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2362s21c1
Sequence:CCGGGACAGTCTCCGGGTCTTAAATCTCGAGATTTAAGACCCGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2069s21c1
Sequence:CCGGAGACTCTTCTCACTAACATACCTCGAGGTATGTTAGTGAGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2473s21c1
Sequence:CCGGACTACTGTCATGTACTGAATACTCGAGTATTCAGTACATGACAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-873s1c1
Sequence:CCGGCCCAGAGAACTCTCACATCATCTCGAGATGATGTGAGAGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1742s1c1
Sequence:CCGGGCATCGACAAACTTTCTCTAACTCGAGTTAGAGAAAGTTTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-801s1c1
Sequence:CCGGCCTCTACAATGACTGCACCAACTCGAGTTGGTGCAGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1731s1c1
Sequence:CCGGCGCAAGAGACAGCATCGACAACTCGAGTTGTCGATGCTGTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1035s1c1
Sequence:CCGGGAGCAACTATCATGCCAGTAACTCGAGTTACTGGCATGATAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007826
DACH1 MISSION shRNA Lentiviral Transduction Particles
dachshund homolog 1 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2362s21c1
Sequence:CCGGGACAGTCTCCGGGTCTTAAATCTCGAGATTTAAGACCCGGAGACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2069s21c1
Sequence:CCGGAGACTCTTCTCACTAACATACCTCGAGGTATGTTAGTGAGAAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007826.2-2473s21c1
Sequence:CCGGACTACTGTCATGTACTGAATACTCGAGTATTCAGTACATGACAGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-873s1c1
Sequence:CCGGCCCAGAGAACTCTCACATCATCTCGAGATGATGTGAGAGTTCTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1742s1c1
Sequence:CCGGGCATCGACAAACTTTCTCTAACTCGAGTTAGAGAAAGTTTGTCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-801s1c1
Sequence:CCGGCCTCTACAATGACTGCACCAACTCGAGTTGGTGCAGTCATTGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1731s1c1
Sequence:CCGGCGCAAGAGACAGCATCGACAACTCGAGTTGTCGATGCTGTCTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007826.1-1035s1c1
Sequence:CCGGGAGCAACTATCATGCCAGTAACTCGAGTTACTGGCATGATAGTTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004392
VALIDATED
DACH1 MISSION shRNA Bacterial Glycerol Stock
dachshund homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004392.4-1543s21c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1744s21c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1358s21c1
Sequence:CCGGTCATGTCTCCTGGGATAATTCCTCGAGGAATTATCCCAGGAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1809s21c1
Sequence:CCGGAGATAGTCTCAGGGTCTTAAACTCGAGTTTAAGACCCTGAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004392.4-2208s21c1
Sequence:CCGGCAATTGTATACAGAGTTAAAGCTCGAGCTTTAACTCTGTATACAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1325s1c1
Sequence:CCGGACTCTCACATCATGCCGCATTCTCGAGAATGCGGCATGATGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-3986s1c1
Sequence:CCGGCCTGTTTGTTATGTGGATTAACTCGAGTTAATCCACATAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1543s1c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1744s1c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1542s1c1
Sequence:CCGGGCTGTTGAAAGTTGCCATAGACTCGAGTCTATGGCAACTTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004392
VALIDATED
DACH1 MISSION shRNA shRNA Plasmid DNA
dachshund homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004392.4-1543s21c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1744s21c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1358s21c1
Sequence:CCGGTCATGTCTCCTGGGATAATTCCTCGAGGAATTATCCCAGGAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1809s21c1
Sequence:CCGGAGATAGTCTCAGGGTCTTAAACTCGAGTTTAAGACCCTGAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004392.4-2208s21c1
Sequence:CCGGCAATTGTATACAGAGTTAAAGCTCGAGCTTTAACTCTGTATACAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1325s1c1
Sequence:CCGGACTCTCACATCATGCCGCATTCTCGAGAATGCGGCATGATGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-3986s1c1
Sequence:CCGGCCTGTTTGTTATGTGGATTAACTCGAGTTAATCCACATAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1543s1c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1744s1c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1542s1c1
Sequence:CCGGGCTGTTGAAAGTTGCCATAGACTCGAGTCTATGGCAACTTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004392
VALIDATED
DACH1 MISSION shRNA Lentiviral Transduction Particles
dachshund homolog 1 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004392.4-1543s21c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1744s21c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1358s21c1
Sequence:CCGGTCATGTCTCCTGGGATAATTCCTCGAGGAATTATCCCAGGAGACATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004392.4-1809s21c1
Sequence:CCGGAGATAGTCTCAGGGTCTTAAACTCGAGTTTAAGACCCTGAGACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294326    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004392.4-2208s21c1
Sequence:CCGGCAATTGTATACAGAGTTAAAGCTCGAGCTTTAACTCTGTATACAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1325s1c1
Sequence:CCGGACTCTCACATCATGCCGCATTCTCGAGAATGCGGCATGATGTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-3986s1c1
Sequence:CCGGCCTGTTTGTTATGTGGATTAACTCGAGTTAATCCACATAACAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1543s1c1
Sequence:CCGGCTGTTGAAAGTTGCCATAGATCTCGAGATCTATGGCAACTTTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1744s1c1
Sequence:CCGGGCACTTGAGTTTGAGACGAAACTCGAGTTTCGTCTCAAACTCAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004392.4-1542s1c1
Sequence:CCGGGCTGTTGAAAGTTGCCATAGACTCGAGTCTATGGCAACTTTCAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks