EMAIL THIS PAGE TO A FRIEND

DACH2

dachshund homolog 2 (Drosophila)

214 Gene Product Result for
UniProtKB ID: Q96NX9, B1AJV3, B4DQG3, Q8NAY3, Q8ND17, Q96N55
Gene ID:
Human(117154) Summary: This gene is one of two genes which encode a protein similar to the Drosophila protein dachshund, a transcription factor involved in cell fate determination in the eye, limb and genital disc of the fly. The encoded protein contains two characteristic dachshund domains: an N-terminal domain responsible for DNA binding and a C-terminal domain responsible for protein-protein interactions. This gene is located on the X chromosome and is subject to inactivation by DNA methylation. The encoded protein may be involved in regulation of organogenesis and myogenesis, and may play a role in premature ovarian failure. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008]
Mouse(93837) dachshund 2 (Drosophila)
Rat(302333) dachshund homolog 2 (Drosophila)
sheep(101102538) dachshund homolog 2 (Drosophila)
chicken(395576) dachshund homolog 2 (Drosophila)
cow(614223) dachshund homolog 2 (Drosophila)
Horse(100071693) dachshund homolog 2 (Drosophila)
domestic cat(101095555) dachshund homolog 2 (Drosophila)
dog(612847) dachshund homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033605 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033605 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033605 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053281 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053281 Rosetta Predictions human pricing
XM_001055336 Rosetta Predictions rat pricing
XM_228458 Rosetta Predictions rat pricing
NM_033605 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186073 predicted 1212
2 SASI_Hs01_00186074 predicted 790
3 SASI_Hs01_00186075 predicted 937
4 SASI_Hs01_00186076 predicted 605
5 SASI_Hs01_00186077 predicted 735
6 SASI_Hs01_00186078 predicted 1751
7 SASI_Hs01_00186079 predicted 1012
8 SASI_Hs01_00186080 predicted 622
9 SASI_Hs01_00186082 predicted 1053
10 SASI_Hs02_00361918 predicted 222
11 SASI_Hs01_00186081 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279239 predicted 1469
2 SASI_Rn02_00279240 predicted 1084
3 SASI_Rn02_00279241 predicted 1538
4 SASI_Rn02_00279242 predicted 1601
5 SASI_Rn02_00279243 predicted 746
6 SASI_Rn02_00279244 predicted 1818
7 SASI_Rn02_00279245 predicted 1155
8 SASI_Rn02_00279246 predicted 944
9 SASI_Rn02_00279247 predicted 1028
10 SASI_Rn02_00279248 predicted 1909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385102 predicted 1407
2 SASI_Rn02_00385103 predicted 1094
3 SASI_Rn02_00385104 predicted 1476
4 SASI_Rn02_00385105 predicted 1365
5 SASI_Rn02_00385106 predicted 1536
6 SASI_Rn02_00385107 predicted 762
7 SASI_Rn02_00385108 predicted 1744
8 SASI_Rn02_00385109 predicted 1172
9 SASI_Rn02_00385110 predicted 962
10 SASI_Rn02_00385111 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033605 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104722 predicted 1195
2 SASI_Mm01_00104723 predicted 1126
3 SASI_Mm01_00104725 predicted 1524
4 SASI_Mm01_00104726 predicted 1205
5 SASI_Mm01_00104727 predicted 815
6 SASI_Mm01_00104728 predicted 560
7 SASI_Mm01_00104729 predicted 1442
8 SASI_Mm01_00104730 predicted 989
9 SASI_Mm01_00104731 predicted 1916
10 SASI_Mm02_00337465 predicted 1647
11 SASI_Mm01_00104724 predicted 651
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033605
DACH2 MISSION shRNA Bacterial Glycerol Stock
dachshund homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033605.2-2685s1c1
Sequence:CCGGCGTGTTTAGAATAACCAACATCTCGAGATGTTGGTTATTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1442s1c1
Sequence:CCGGCCAACAATCGAGAAGAGCTTACTCGAGTAAGCTCTTCTCGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-991s1c1
Sequence:CCGGGATAAGATACAATCTCCACTTCTCGAGAAGTGGAGATTGTATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1400s1c1
Sequence:CCGGCCTCGCAGATGGATCATCATTCTCGAGAATGATGATCCATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-288s1c1
Sequence:CCGGCCCTAACATGATCAACAGTTTCTCGAGAAACTGTTGATCATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2136s21c1
Sequence:CCGGATATCCATCATGGAGTTATTTCTCGAGAAATAACTCCATGATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2108s21c1
Sequence:CCGGTACTTGTGATTCCAGTATATCCTCGAGGATATACTGGAATCACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033605.2-527s21c1
Sequence:CCGGAGCTGAAGAGACTCGACATATCTCGAGATATGTCGAGTCTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2259s21c1
Sequence:CCGGTAATCTTTGTCCTGGTATTAGCTCGAGCTAATACCAGGACAAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033605
DACH2 MISSION shRNA shRNA Plasmid DNA
dachshund homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033605.2-2685s1c1
Sequence:CCGGCGTGTTTAGAATAACCAACATCTCGAGATGTTGGTTATTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1442s1c1
Sequence:CCGGCCAACAATCGAGAAGAGCTTACTCGAGTAAGCTCTTCTCGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-991s1c1
Sequence:CCGGGATAAGATACAATCTCCACTTCTCGAGAAGTGGAGATTGTATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1400s1c1
Sequence:CCGGCCTCGCAGATGGATCATCATTCTCGAGAATGATGATCCATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-288s1c1
Sequence:CCGGCCCTAACATGATCAACAGTTTCTCGAGAAACTGTTGATCATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2136s21c1
Sequence:CCGGATATCCATCATGGAGTTATTTCTCGAGAAATAACTCCATGATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2108s21c1
Sequence:CCGGTACTTGTGATTCCAGTATATCCTCGAGGATATACTGGAATCACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033605.2-527s21c1
Sequence:CCGGAGCTGAAGAGACTCGACATATCTCGAGATATGTCGAGTCTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2259s21c1
Sequence:CCGGTAATCTTTGTCCTGGTATTAGCTCGAGCTAATACCAGGACAAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033605
DACH2 MISSION shRNA Lentiviral Transduction Particles
dachshund homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108575    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033605.2-2685s1c1
Sequence:CCGGCGTGTTTAGAATAACCAACATCTCGAGATGTTGGTTATTCTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1442s1c1
Sequence:CCGGCCAACAATCGAGAAGAGCTTACTCGAGTAAGCTCTTCTCGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-991s1c1
Sequence:CCGGGATAAGATACAATCTCCACTTCTCGAGAAGTGGAGATTGTATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-1400s1c1
Sequence:CCGGCCTCGCAGATGGATCATCATTCTCGAGAATGATGATCCATCTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033605.2-288s1c1
Sequence:CCGGCCCTAACATGATCAACAGTTTCTCGAGAAACTGTTGATCATGTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2136s21c1
Sequence:CCGGATATCCATCATGGAGTTATTTCTCGAGAAATAACTCCATGATGGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2108s21c1
Sequence:CCGGTACTTGTGATTCCAGTATATCCTCGAGGATATACTGGAATCACAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033605.2-527s21c1
Sequence:CCGGAGCTGAAGAGACTCGACATATCTCGAGATATGTCGAGTCTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033605.2-2259s21c1
Sequence:CCGGTAATCTTTGTCCTGGTATTAGCTCGAGCTAATACCAGGACAAAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053281
DACH2 MISSION shRNA Bacterial Glycerol Stock
dachshund homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-105s1c1
Sequence:CCGGCCCTCGTCTTACTCCTAATATCTCGAGATATTAGGAGTAAGACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1207s1c1
Sequence:CCGGCCCTCTCAGATGGATCATCATCTCGAGATGATGATCCATCTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-138s1c1
Sequence:CCGGCGTGGTTAATAACCACAGCAACTCGAGTTGCTGTGGTTATTAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1749s1c1
Sequence:CCGGAGGAGGTAACTATTACTGTTTCTCGAGAAACAGTAATAGTTACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-943s1c1
Sequence:CCGGCCATTTATGATGATGCCTCATCTCGAGATGAGGCATCATCATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053281.3-1537s21c1
Sequence:CCGGAGACTCTGTTGACCAACATTCCTCGAGGAATGTTGGTCAACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053281.3-2163s21c1
Sequence:CCGGCATTAGACTGACCAGTTTAAACTCGAGTTTAAACTGGTCAGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053281
DACH2 MISSION shRNA shRNA Plasmid DNA
dachshund homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-105s1c1
Sequence:CCGGCCCTCGTCTTACTCCTAATATCTCGAGATATTAGGAGTAAGACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1207s1c1
Sequence:CCGGCCCTCTCAGATGGATCATCATCTCGAGATGATGATCCATCTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-138s1c1
Sequence:CCGGCGTGGTTAATAACCACAGCAACTCGAGTTGCTGTGGTTATTAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1749s1c1
Sequence:CCGGAGGAGGTAACTATTACTGTTTCTCGAGAAACAGTAATAGTTACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-943s1c1
Sequence:CCGGCCATTTATGATGATGCCTCATCTCGAGATGAGGCATCATCATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053281.3-1537s21c1
Sequence:CCGGAGACTCTGTTGACCAACATTCCTCGAGGAATGTTGGTCAACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053281.3-2163s21c1
Sequence:CCGGCATTAGACTGACCAGTTTAAACTCGAGTTTAAACTGGTCAGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053281
DACH2 MISSION shRNA Lentiviral Transduction Particles
dachshund homolog 2 (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-105s1c1
Sequence:CCGGCCCTCGTCTTACTCCTAATATCTCGAGATATTAGGAGTAAGACGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1207s1c1
Sequence:CCGGCCCTCTCAGATGGATCATCATCTCGAGATGATGATCCATCTGAGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-138s1c1
Sequence:CCGGCGTGGTTAATAACCACAGCAACTCGAGTTGCTGTGGTTATTAACCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-1749s1c1
Sequence:CCGGAGGAGGTAACTATTACTGTTTCTCGAGAAACAGTAATAGTTACCTCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053281.2-943s1c1
Sequence:CCGGCCATTTATGATGATGCCTCATCTCGAGATGAGGCATCATCATAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053281.3-1537s21c1
Sequence:CCGGAGACTCTGTTGACCAACATTCCTCGAGGAATGTTGGTCAACAGAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053281.3-2163s21c1
Sequence:CCGGCATTAGACTGACCAGTTTAAACTCGAGTTTAAACTGGTCAGTCTAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks