EMAIL THIS PAGE TO A FRIEND

DACT1

dishevelled-binding antagonist of beta-catenin 1

153 Gene Product Result for
Synonyms: DAPPER DAPPER1 DPR1 FRODO HDPR1 THYEX3
UniProtKB ID: Q9NYF0, A8MYJ2, Q86TY0
Gene ID:
Human(51339) Summary: The protein encoded by this gene belongs to the dapper family, characterized by the presence of PDZ-binding motif at the C-terminus. It interacts with, and positively regulates dishevelled-mediated signaling pathways during development. Depletion of this mRNA from xenopus embryos resulted in loss of notochord and head structures, and mice lacking this gene died shortly after birth from severe posterior malformations. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(59036) dapper homolog 1, antagonist of beta-catenin (xenopus)
Rat(500666) dishevelled-binding antagonist of beta-catenin 1
Zebrafish(405799) dapper homolog 1, antagonist of beta-catenin (xenopus)
chicken(723789) dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)
domestic cat(101098146) dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)
cow(538778) dishevelled-binding antagonist of beta-catenin 1
dog(100687551) dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)
sheep(101116320) dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)
Domestic Rabbit(100339172) dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)
domestic guinea pig(100728819) dishevelled-binding antagonist of beta-catenin 1
naked mole-rat(101713951) dishevelled-binding antagonist of beta-catenin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016651 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU008031 MISSION® esiRNA esiRNA targeting mouse Dact1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079520 Rosetta Predictions human pricing
NM_016651 Rosetta Predictions human pricing
XM_001077448 Rosetta Predictions rat pricing
XM_576044 Rosetta Predictions rat pricing
NM_021532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079520 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313430 predicted 1417
2 SASI_Hs02_00313431 predicted 2068
3 SASI_Hs02_00313432 predicted 1437
4 SASI_Hs02_00313433 predicted 1287
5 SASI_Hs02_00313434 predicted 1430
6 SASI_Hs02_00313435 predicted 1154
7 SASI_Hs02_00313436 predicted 2989
8 SASI_Hs02_00313437 predicted 1298
9 SASI_Hs02_00313438 predicted 2097
10 SASI_Hs02_00313439 predicted 1895
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349828 predicted 1524
2 SASI_Hs01_00167983 predicted 2178
3 SASI_Hs02_00349829 predicted 1553
4 SASI_Hs02_00349830 predicted 1402
5 SASI_Hs02_00349831 predicted 1545
6 SASI_Hs02_00349832 predicted 1274
7 SASI_Hs02_00349833 predicted 3102
8 SASI_Hs02_00349834 predicted 1406
9 SASI_Hs02_00349835 predicted 2210
10 SASI_Hs02_00349836 predicted 2007
11 SASI_Hs01_00167982 predicted 901
12 SASI_Hs01_00167984 predicted 611
13 SASI_Hs01_00167985 predicted 1781
14 SASI_Hs01_00167986 predicted 847
15 SASI_Hs01_00167987 predicted 689
16 SASI_Hs01_00167988 predicted 829
17 SASI_Hs01_00167989 predicted 1279
18 SASI_Hs01_00167990 predicted 1233
19 SASI_Hs01_00167991 predicted 2070
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357069 predicted 883
2 SASI_Rn02_00357070 predicted 1563
3 SASI_Rn02_00357071 predicted 1433
4 SASI_Rn02_00357072 predicted 1201
5 SASI_Rn02_00357073 predicted 1213
6 SASI_Rn02_00357074 predicted 550
7 SASI_Rn02_00357075 predicted 1016
8 SASI_Rn02_00357076 predicted 668
9 SASI_Rn02_00357077 predicted 1273
10 SASI_Rn02_00357078 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576044 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404669 predicted 927
2 SASI_Rn02_00404670 predicted 1618
3 SASI_Rn02_00404671 predicted 1488
4 SASI_Rn02_00404672 predicted 1255
5 SASI_Rn02_00404673 predicted 1254
6 SASI_Rn02_00404674 predicted 606
7 SASI_Rn02_00404675 predicted 1056
8 SASI_Rn02_00404676 predicted 708
9 SASI_Rn02_00404677 predicted 1324
10 SASI_Rn02_00404678 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061138 predicted 706
2 SASI_Mm02_00326269 predicted 316
3 SASI_Mm01_00061140 predicted 1130
4 SASI_Mm01_00061141 predicted 522
5 SASI_Mm01_00061143 predicted 1641
6 SASI_Mm01_00061145 predicted 654
7 SASI_Mm01_00061146 predicted 602
8 SASI_Mm01_00061147 predicted 920
9 SASI_Mm02_00326270 predicted 367
10 SASI_Mm02_00326271 predicted 372
11 SASI_Mm01_00061139 predicted 497
12 SASI_Mm01_00061142 predicted 821
13 SASI_Mm01_00061144 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021532
VALIDATED
DACT1 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-856s21c1
Sequence:CCGGTCCCATCCTGCATCCAGTAAGCTCGAGCTTACTGGATGCAGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1485s21c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-609s21c1
Sequence:CCGGTGCAGATGTGAATCCTAAATACTCGAGTATTTAGGATTCACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1666s21c1
Sequence:CCGGCCAGACGACTCGGATACAAATCTCGAGATTTGTATCCGAGTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-826s21c1
Sequence:CCGGCTGCCATCTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAGATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1025s1c1
Sequence:CCGGCGGGCAGTAGTGTGAACTTTACTCGAGTAAAGTTCACACTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1671s1c1
Sequence:CCGGCGACTCGGATACAAATAAGAACTCGAGTTCTTATTTGTATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-312s1c1
Sequence:CCGGGCGAAGGCAGTTGAATTGTTTCTCGAGAAACAATTCAACTGCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-1485s1c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-629s1c1
Sequence:CCGGACCAGTGTGATCTTGTGTCTACTCGAGTAGACACAAGATCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021532
VALIDATED
DACT1 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-856s21c1
Sequence:CCGGTCCCATCCTGCATCCAGTAAGCTCGAGCTTACTGGATGCAGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1485s21c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-609s21c1
Sequence:CCGGTGCAGATGTGAATCCTAAATACTCGAGTATTTAGGATTCACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1666s21c1
Sequence:CCGGCCAGACGACTCGGATACAAATCTCGAGATTTGTATCCGAGTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-826s21c1
Sequence:CCGGCTGCCATCTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAGATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1025s1c1
Sequence:CCGGCGGGCAGTAGTGTGAACTTTACTCGAGTAAAGTTCACACTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1671s1c1
Sequence:CCGGCGACTCGGATACAAATAAGAACTCGAGTTCTTATTTGTATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-312s1c1
Sequence:CCGGGCGAAGGCAGTTGAATTGTTTCTCGAGAAACAATTCAACTGCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-1485s1c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-629s1c1
Sequence:CCGGACCAGTGTGATCTTGTGTCTACTCGAGTAGACACAAGATCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021532
VALIDATED
DACT1 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-856s21c1
Sequence:CCGGTCCCATCCTGCATCCAGTAAGCTCGAGCTTACTGGATGCAGGATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1485s21c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021532.3-609s21c1
Sequence:CCGGTGCAGATGTGAATCCTAAATACTCGAGTATTTAGGATTCACATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-1666s21c1
Sequence:CCGGCCAGACGACTCGGATACAAATCTCGAGATTTGTATCCGAGTCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021532.3-826s21c1
Sequence:CCGGCTGCCATCTCCAAGCAGTTTGCTCGAGCAAACTGCTTGGAGATGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1025s1c1
Sequence:CCGGCGGGCAGTAGTGTGAACTTTACTCGAGTAAAGTTCACACTACTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-1671s1c1
Sequence:CCGGCGACTCGGATACAAATAAGAACTCGAGTTCTTATTTGTATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021532.2-312s1c1
Sequence:CCGGGCGAAGGCAGTTGAATTGTTTCTCGAGAAACAATTCAACTGCCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-1485s1c1
Sequence:CCGGGCATCTGGTGAAAGCTCAGTTCTCGAGAACTGAGCTTTCACCAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021532.2-629s1c1
Sequence:CCGGACCAGTGTGATCTTGTGTCTACTCGAGTAGACACAAGATCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016651
VALIDATED
DACT1 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-802s21c1
Sequence:CCGGTCATAGGATTGTTGGAATATACTCGAGTATATTCCAACAATCCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-868s21c1
Sequence:CCGGCCCTCTCCACACCACAATTTACTCGAGTAAATTGTGGTGTGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-2667s21c1
Sequence:CCGGACGGTTTGAGTGACATCATTGCTCGAGCAATGATGTCACTCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016651.5-3538s21c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-1822s21c1
Sequence:CCGGACCTGGTCAAGGCCCAGTTTACTCGAGTAAACTGGGCCTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-3436s1c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1271s1c1
Sequence:CCGGCGGGATACCTTCTCTGAACAACTCGAGTTGTTCAGAGAAGGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3249s1c1
Sequence:CCGGCCGTTTATCCAACATTTAGATCTCGAGATCTAAATGTTGGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2504s1c1
Sequence:CCGGCTCACATAACCTCAAGAAGAACTCGAGTTCTTCTTGAGGTTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3139s1c1
Sequence:CCGGCCAAACCTTAAATCCAGAGATCTCGAGATCTCTGGATTTAAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-386s1c1
Sequence:CCGGCTTGCTGCTAAGAAAGCAATTCTCGAGAATTGCTTTCTTAGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1313s1c1
Sequence:CCGGGCAGTGGTCGAAAGAATCAAACTCGAGTTTGATTCTTTCGACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2431s1c1
Sequence:CCGGCTCTGCCCATTCAAACGGTAACTCGAGTTACCGTTTGAATGGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2062s1c1
Sequence:CCGGCCAAACCTAAGCACAAGCGAACTCGAGTTCGCTTGTGCTTAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2297s1c1
Sequence:CCGGGCAGAGCAATTACACCACCAACTCGAGTTGGTGGTGTAATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3356s1c1
Sequence:CCGGGCACAGAGACATTCACTATTACTCGAGTAATAGTGAATGTCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016651
VALIDATED
DACT1 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-802s21c1
Sequence:CCGGTCATAGGATTGTTGGAATATACTCGAGTATATTCCAACAATCCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-868s21c1
Sequence:CCGGCCCTCTCCACACCACAATTTACTCGAGTAAATTGTGGTGTGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-2667s21c1
Sequence:CCGGACGGTTTGAGTGACATCATTGCTCGAGCAATGATGTCACTCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016651.5-3538s21c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-1822s21c1
Sequence:CCGGACCTGGTCAAGGCCCAGTTTACTCGAGTAAACTGGGCCTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-3436s1c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1271s1c1
Sequence:CCGGCGGGATACCTTCTCTGAACAACTCGAGTTGTTCAGAGAAGGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3249s1c1
Sequence:CCGGCCGTTTATCCAACATTTAGATCTCGAGATCTAAATGTTGGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2504s1c1
Sequence:CCGGCTCACATAACCTCAAGAAGAACTCGAGTTCTTCTTGAGGTTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3139s1c1
Sequence:CCGGCCAAACCTTAAATCCAGAGATCTCGAGATCTCTGGATTTAAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-386s1c1
Sequence:CCGGCTTGCTGCTAAGAAAGCAATTCTCGAGAATTGCTTTCTTAGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1313s1c1
Sequence:CCGGGCAGTGGTCGAAAGAATCAAACTCGAGTTTGATTCTTTCGACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2431s1c1
Sequence:CCGGCTCTGCCCATTCAAACGGTAACTCGAGTTACCGTTTGAATGGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2062s1c1
Sequence:CCGGCCAAACCTAAGCACAAGCGAACTCGAGTTCGCTTGTGCTTAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2297s1c1
Sequence:CCGGGCAGAGCAATTACACCACCAACTCGAGTTGGTGGTGTAATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3356s1c1
Sequence:CCGGGCACAGAGACATTCACTATTACTCGAGTAATAGTGAATGTCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016651
VALIDATED
DACT1 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-802s21c1
Sequence:CCGGTCATAGGATTGTTGGAATATACTCGAGTATATTCCAACAATCCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-868s21c1
Sequence:CCGGCCCTCTCCACACCACAATTTACTCGAGTAAATTGTGGTGTGGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-2667s21c1
Sequence:CCGGACGGTTTGAGTGACATCATTGCTCGAGCAATGATGTCACTCAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016651.5-3538s21c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016651.5-1822s21c1
Sequence:CCGGACCTGGTCAAGGCCCAGTTTACTCGAGTAAACTGGGCCTTGACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-3436s1c1
Sequence:CCGGCGAAGCGTTGACCTGAACATACTCGAGTATGTTCAGGTCAACGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166289    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1271s1c1
Sequence:CCGGCGGGATACCTTCTCTGAACAACTCGAGTTGTTCAGAGAAGGTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3249s1c1
Sequence:CCGGCCGTTTATCCAACATTTAGATCTCGAGATCTAAATGTTGGATAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2504s1c1
Sequence:CCGGCTCACATAACCTCAAGAAGAACTCGAGTTCTTCTTGAGGTTATGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160565    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3139s1c1
Sequence:CCGGCCAAACCTTAAATCCAGAGATCTCGAGATCTCTGGATTTAAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016651.4-386s1c1
Sequence:CCGGCTTGCTGCTAAGAAAGCAATTCTCGAGAATTGCTTTCTTAGCAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-1313s1c1
Sequence:CCGGGCAGTGGTCGAAAGAATCAAACTCGAGTTTGATTCTTTCGACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2431s1c1
Sequence:CCGGCTCTGCCCATTCAAACGGTAACTCGAGTTACCGTTTGAATGGGCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164747    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2062s1c1
Sequence:CCGGCCAAACCTAAGCACAAGCGAACTCGAGTTCGCTTGTGCTTAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165973    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016651.4-2297s1c1
Sequence:CCGGGCAGAGCAATTACACCACCAACTCGAGTTGGTGGTGTAATTGCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159640    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016651.4-3356s1c1
Sequence:CCGGGCACAGAGACATTCACTATTACTCGAGTAATAGTGAATGTCTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks