EMAIL THIS PAGE TO A FRIEND

DACT2

dishevelled-binding antagonist of beta-catenin 2

53 Gene Product Result for
Synonyms: C6orf116 DAPPER2 DPR2 RP11-503C24.7 bA503C24.7
UniProtKB ID: Q5SW24, Q2NKJ2, Q569G0, Q8WYW2
Gene ID:
Mouse(240025) dapper homolog 2, antagonist of beta-catenin (xenopus)
Rat(308212) dishevelled-binding antagonist of beta-catenin 2
naked mole-rat(101725793) dishevelled-binding antagonist of beta-catenin 2
domestic guinea pig(100736102) dishevelled-binding antagonist of beta-catenin 2
sheep(101116322) dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)
Zebrafish(337795) dapper homolog 2, antagonist of beta-catenin (xenopus)
cow(787318) dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)
domestic cat(101082157) dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)
dog(612487) dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)
chicken(421561) dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_214462 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_214462 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_214462 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172826 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172826 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172826 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_214462 Rosetta Predictions human pricing
NM_001107464 Rosetta Predictions rat pricing
NM_172826 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_214462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00374369 predicted 1080
2 SASI_Hs01_00217607 predicted 2454
3 SASI_Hs02_00374370 predicted 2417
4 SASI_Hs02_00374371 predicted 1016
5 SASI_Hs02_00374372 predicted 1124
6 SASI_Hs02_00374373 predicted 717
7 SASI_Hs01_00217608 predicted 2548
8 SASI_Hs01_00217609 predicted 1387
9 SASI_Hs02_00374374 predicted 2455
10 SASI_Hs01_00217610 predicted 2513
11 SASI_Hs01_00217606 predicted 2701
12 SASI_Hs01_00217611 predicted 1529
13 SASI_Hs01_00217612 predicted 2494
14 SASI_Hs01_00217613 predicted 1448
15 SASI_Hs01_00217614 predicted 2082
16 SASI_Hs01_00217615 predicted 2324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107464 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229085 predicted 865
2 SASI_Rn02_00229086 predicted 1981
3 SASI_Rn02_00229087 predicted 1308
4 SASI_Rn02_00229088 predicted 2078
5 SASI_Rn02_00229089 predicted 2392
6 SASI_Rn02_00229090 predicted 375
7 SASI_Rn02_00229091 predicted 2235
8 SASI_Rn02_00229092 predicted 1978
9 SASI_Rn02_00229093 predicted 1418
10 SASI_Rn02_00229094 predicted 1409
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172826 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181894 predicted 651
2 SASI_Mm01_00181895 predicted 748
3 SASI_Mm01_00181896 predicted 1738
4 SASI_Mm01_00181898 predicted 727
5 SASI_Mm01_00181899 predicted 1314
6 SASI_Mm01_00181900 predicted 2235
7 SASI_Mm02_00344757 predicted 2133
8 SASI_Mm01_00181901 predicted 2379
9 SASI_Mm01_00181902 predicted 710
10 SASI_Mm01_00181903 predicted 1643
11 SASI_Mm01_00181897 predicted 1248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_214462
DACT2 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214462.1-1586s1c1
Sequence:CCGGCAAGAGAAGTCCCATGGACAACTCGAGTTGTCCATGGGACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2822s1c1
Sequence:CCGGCAGGACTTTGAGCTGGAAATTCTCGAGAATTTCCAGCTCAAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2769s1c1
Sequence:CCGGGTTTCCCAATCCTTTGACCATCTCGAGATGGTCAAAGGATTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2825s1c1
Sequence:CCGGGACTTTGAGCTGGAAATTGAACTCGAGTTCAATTTCCAGCTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2697s1c1
Sequence:CCGGCATGCACCTTGTTTCCATGTTCTCGAGAACATGGAAACAAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-1453s21c1
Sequence:CCGGATGGACGAGGCAACATCATATCTCGAGATATGATGTTGCCTCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214462.3-2473s21c1
Sequence:CCGGTCCTGTGCATGTCTGGGTTTCCTCGAGGAAACCCAGACATGCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-347s21c1
Sequence:CCGGACAACAGGACATCGGCCTGAACTCGAGTTCAGGCCGATGTCCTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-2319s21c1
Sequence:CCGGGTGCCCAAGCTGTGCCGTATTCTCGAGAATACGGCACAGCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_214462
DACT2 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214462.1-1586s1c1
Sequence:CCGGCAAGAGAAGTCCCATGGACAACTCGAGTTGTCCATGGGACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2822s1c1
Sequence:CCGGCAGGACTTTGAGCTGGAAATTCTCGAGAATTTCCAGCTCAAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2769s1c1
Sequence:CCGGGTTTCCCAATCCTTTGACCATCTCGAGATGGTCAAAGGATTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2825s1c1
Sequence:CCGGGACTTTGAGCTGGAAATTGAACTCGAGTTCAATTTCCAGCTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2697s1c1
Sequence:CCGGCATGCACCTTGTTTCCATGTTCTCGAGAACATGGAAACAAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-1453s21c1
Sequence:CCGGATGGACGAGGCAACATCATATCTCGAGATATGATGTTGCCTCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214462.3-2473s21c1
Sequence:CCGGTCCTGTGCATGTCTGGGTTTCCTCGAGGAAACCCAGACATGCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-347s21c1
Sequence:CCGGACAACAGGACATCGGCCTGAACTCGAGTTCAGGCCGATGTCCTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-2319s21c1
Sequence:CCGGGTGCCCAAGCTGTGCCGTATTCTCGAGAATACGGCACAGCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_214462
DACT2 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180335    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_214462.1-1586s1c1
Sequence:CCGGCAAGAGAAGTCCCATGGACAACTCGAGTTGTCCATGGGACTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2822s1c1
Sequence:CCGGCAGGACTTTGAGCTGGAAATTCTCGAGAATTTCCAGCTCAAAGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2769s1c1
Sequence:CCGGGTTTCCCAATCCTTTGACCATCTCGAGATGGTCAAAGGATTGGGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2825s1c1
Sequence:CCGGGACTTTGAGCTGGAAATTGAACTCGAGTTCAATTTCCAGCTCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148739    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_214462.1-2697s1c1
Sequence:CCGGCATGCACCTTGTTTCCATGTTCTCGAGAACATGGAAACAAGGTGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-1453s21c1
Sequence:CCGGATGGACGAGGCAACATCATATCTCGAGATATGATGTTGCCTCGTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_214462.3-2473s21c1
Sequence:CCGGTCCTGTGCATGTCTGGGTTTCCTCGAGGAAACCCAGACATGCACAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-347s21c1
Sequence:CCGGACAACAGGACATCGGCCTGAACTCGAGTTCAGGCCGATGTCCTGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_214462.3-2319s21c1
Sequence:CCGGGTGCCCAAGCTGTGCCGTATTCTCGAGAATACGGCACAGCTTGGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172826
DACT2 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2395s1c1
Sequence:CCGGGCAACGATTCAGAAGGGTGTTCTCGAGAACACCCTTCTGAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2546s1c1
Sequence:CCGGGCCCAAACTGTGCCGCATCAACTCGAGTTGATGCGGCACAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-1729s1c1
Sequence:CCGGCGGAGCCCTTTGCCTATACATCTCGAGATGTATAGGCAAAGGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-638s1c1
Sequence:CCGGGCAGATAAGTGAACTACAGCTCTCGAGAGCTGTAGTTCACTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-974s1c1
Sequence:CCGGCAGACCAGTATCTACAGGTGACTCGAGTCACCTGTAGATACTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172826
DACT2 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2395s1c1
Sequence:CCGGGCAACGATTCAGAAGGGTGTTCTCGAGAACACCCTTCTGAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2546s1c1
Sequence:CCGGGCCCAAACTGTGCCGCATCAACTCGAGTTGATGCGGCACAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-1729s1c1
Sequence:CCGGCGGAGCCCTTTGCCTATACATCTCGAGATGTATAGGCAAAGGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-638s1c1
Sequence:CCGGGCAGATAAGTGAACTACAGCTCTCGAGAGCTGTAGTTCACTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-974s1c1
Sequence:CCGGCAGACCAGTATCTACAGGTGACTCGAGTCACCTGTAGATACTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172826
DACT2 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2395s1c1
Sequence:CCGGGCAACGATTCAGAAGGGTGTTCTCGAGAACACCCTTCTGAATCGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-2546s1c1
Sequence:CCGGGCCCAAACTGTGCCGCATCAACTCGAGTTGATGCGGCACAGTTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-1729s1c1
Sequence:CCGGCGGAGCCCTTTGCCTATACATCTCGAGATGTATAGGCAAAGGGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-638s1c1
Sequence:CCGGGCAGATAAGTGAACTACAGCTCTCGAGAGCTGTAGTTCACTTATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172826.2-974s1c1
Sequence:CCGGCAGACCAGTATCTACAGGTGACTCGAGTCACCTGTAGATACTGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks