EMAIL THIS PAGE TO A FRIEND

DACT3

dishevelled-binding antagonist of beta-catenin 3

95 Gene Product Result for
Synonyms: DAPPER3 RRR1
UniProtKB ID: Q96B18
Gene ID:
Mouse(629378) dapper homolog 3, antagonist of beta-catenin (xenopus)
Rat(499088) dishevelled-binding antagonist of beta-catenin 3
cow(539209) dishevelled-binding antagonist of beta-catenin 3
domestic cat(101100351) dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)
dog(612178) dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)
sheep(101121703) dapper, antagonist of beta-catenin, homolog 3 (Xenopus laevis)
domestic guinea pig(100726263) dishevelled-binding antagonist of beta-catenin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001081655 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081655 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081655 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145056 Rosetta Predictions human pricing
XM_574375 Rosetta Predictions rat pricing
NM_001081655 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145056 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117848 predicted 1332
2 SASI_Hs01_00117850 predicted 1919
3 SASI_Hs01_00117851 predicted 2456
4 SASI_Hs02_00364950 predicted 2457
5 SASI_Hs01_00117853 predicted 1789
6 SASI_Hs02_00364951 predicted 1910
7 SASI_Hs01_00117855 predicted 1494
8 SASI_Hs01_00117856 predicted 1449
9 SASI_Hs02_00364952 predicted 2447
10 SASI_Hs02_00364953 predicted 1623
11 SASI_Hs01_00117849 predicted 819
12 SASI_Hs01_00117852 predicted 890
13 SASI_Hs01_00117854 predicted 971
14 SASI_Hs01_00117857 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401880 predicted 2273
2 SASI_Rn02_00401881 predicted 2437
3 SASI_Rn02_00401882 predicted 2371
4 SASI_Rn02_00401883 predicted 2099
5 SASI_Rn02_00401884 predicted 2285
6 SASI_Rn02_00401885 predicted 2000
7 SASI_Rn02_00401886 predicted 2252
8 SASI_Rn02_00401887 predicted 561
9 SASI_Rn02_00401888 predicted 517
10 SASI_Rn02_00401889 predicted 2114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081655 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298833 predicted 2130
2 SASI_Mm02_00298834 predicted 2421
3 SASI_Mm02_00298835 predicted 2217
4 SASI_Mm02_00298836 predicted 2379
5 SASI_Mm02_00298837 predicted 2231
6 SASI_Mm02_00298838 predicted 1197
7 SASI_Mm02_00298839 predicted 2306
8 SASI_Mm02_00298840 predicted 2216
9 SASI_Mm02_00298841 predicted 582
10 SASI_Mm02_00298842 predicted 512
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081655
DACT3 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 3
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000255233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081655.1-2217s21c1
Sequence:CCGGTACAATGGGTGTACGCAAATGCTCGAGCATTTGCGTACACCCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1845s21c1
Sequence:CCGGCGCCAAGGTCTTCGTGAAGATCTCGAGATCTTCACGAAGACCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1117s21c1
Sequence:CCGGCTCGTGAAGGCACAGTACATCCTCGAGGATGTACTGTGCCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1909s21c1
Sequence:CCGGTCGGGTTCTCTGAAGGTCATGCTCGAGCATGACCTTCAGAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081655
DACT3 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 3
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000255233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081655.1-2217s21c1
Sequence:CCGGTACAATGGGTGTACGCAAATGCTCGAGCATTTGCGTACACCCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1845s21c1
Sequence:CCGGCGCCAAGGTCTTCGTGAAGATCTCGAGATCTTCACGAAGACCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1117s21c1
Sequence:CCGGCTCGTGAAGGCACAGTACATCCTCGAGGATGTACTGTGCCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1909s21c1
Sequence:CCGGTCGGGTTCTCTGAAGGTCATGCTCGAGCATGACCTTCAGAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081655
DACT3 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 3
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000255233    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081655.1-2217s21c1
Sequence:CCGGTACAATGGGTGTACGCAAATGCTCGAGCATTTGCGTACACCCATTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1845s21c1
Sequence:CCGGCGCCAAGGTCTTCGTGAAGATCTCGAGATCTTCACGAAGACCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1117s21c1
Sequence:CCGGCTCGTGAAGGCACAGTACATCCTCGAGGATGTACTGTGCCTTCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081655.1-1909s21c1
Sequence:CCGGTCGGGTTCTCTGAAGGTCATGCTCGAGCATGACCTTCAGAGAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145056
DACT3 MISSION shRNA Bacterial Glycerol Stock
dishevelled-binding antagonist of beta-catenin 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2386s1c1
Sequence:CCGGCAGCTGTTCCAATCTAGTATTCTCGAGAATACTAGATTGGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2257s1c1
Sequence:CCGGGAAGGACTCTTTCACTTCGATCTCGAGATCGAAGTGAAAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2279s1c1
Sequence:CCGGCCTGGACAATTATGGAGGATTCTCGAGAATCCTCCATAATTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145056.1-1627s1c1
Sequence:CCGGGTTCTCTCAAGGTCATGACTACTCGAGTAGTCATGACCTTGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145056.1-2194s1c1
Sequence:CCGGGAAGGGAAGGAGCACTGATTTCTCGAGAAATCAGTGCTCCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-1784s1c1
Sequence:CCGGCCACTCCTAACAGTCTTGGTTCTCGAGAACCAAGACTGTTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145056
DACT3 MISSION shRNA shRNA Plasmid DNA
dishevelled-binding antagonist of beta-catenin 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2386s1c1
Sequence:CCGGCAGCTGTTCCAATCTAGTATTCTCGAGAATACTAGATTGGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2257s1c1
Sequence:CCGGGAAGGACTCTTTCACTTCGATCTCGAGATCGAAGTGAAAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2279s1c1
Sequence:CCGGCCTGGACAATTATGGAGGATTCTCGAGAATCCTCCATAATTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145056.1-1627s1c1
Sequence:CCGGGTTCTCTCAAGGTCATGACTACTCGAGTAGTCATGACCTTGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145056.1-2194s1c1
Sequence:CCGGGAAGGGAAGGAGCACTGATTTCTCGAGAAATCAGTGCTCCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-1784s1c1
Sequence:CCGGCCACTCCTAACAGTCTTGGTTCTCGAGAACCAAGACTGTTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145056
DACT3 MISSION shRNA Lentiviral Transduction Particles
dishevelled-binding antagonist of beta-catenin 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144243    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2386s1c1
Sequence:CCGGCAGCTGTTCCAATCTAGTATTCTCGAGAATACTAGATTGGAACAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142049    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2257s1c1
Sequence:CCGGGAAGGACTCTTTCACTTCGATCTCGAGATCGAAGTGAAAGAGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-2279s1c1
Sequence:CCGGCCTGGACAATTATGGAGGATTCTCGAGAATCCTCCATAATTGTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145056.1-1627s1c1
Sequence:CCGGGTTCTCTCAAGGTCATGACTACTCGAGTAGTCATGACCTTGAGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140217    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145056.1-2194s1c1
Sequence:CCGGGAAGGGAAGGAGCACTGATTTCTCGAGAAATCAGTGCTCCTTCCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145056.1-1784s1c1
Sequence:CCGGCCACTCCTAACAGTCTTGGTTCTCGAGAACCAAGACTGTTAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks