EMAIL THIS PAGE TO A FRIEND

DAD1

defender against cell death 1

95 Gene Product Result for
Synonyms: OST2
Gene ID:
Human(1603) Summary: DAD1, the defender against apoptotic cell death, was initially identified as a negative regulator of programmed cell death in the temperature sensitive tsBN7 cell line. The DAD1 protein disappeared in temperature-sensitive cells following a shift to the nonpermissive temperature, suggesting that loss of the DAD1 protein triggered apoptosis. DAD1 is believed to be a tightly associated subunit of oligosaccharyltransferase both in the intact membrane and in the purified enzyme, thus reflecting the essential nature of N-linked glycosylation in eukaryotes. [provided by RefSeq, Jul 2008]
Mouse(13135) defender against cell death 1
Rat(192275) defender against cell death 1
Zebrafish(566527) defender against cell death 1
cow(614538) defender against cell death 1
domestic cat(101088756) defender against cell death 1
dog(480238) defender against cell death 1
Thale Cress(819090) phospholipase A(1) DAD1
chicken(395343) defender against cell death 1
naked mole-rat(101706224) defender against cell death 1
Goat(100860963) defender against cell death 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001291 MISSION® esiRNA esiRNA targeting human DAD1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001344 siRNAs that have been validated in the lab human pricing
NM_138910 Rosetta Predictions rat pricing
NM_001113358 Rosetta Predictions mouse pricing
NM_010015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001344 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222793 validated 342
1 SASI_Hs01_00222791 validated 387
1 SASI_Hs01_00222794 validated 295
2 SASI_Hs02_00331664 predicted 409
3 SASI_Hs02_00331665 predicted 387
4 SASI_Hs01_00222795 predicted 279
5 SASI_Hs01_00222796 predicted 395
6 SASI_Hs02_00331666 predicted 388
7 SASI_Hs01_00222800 predicted 310
8 SASI_Hs02_00331667 predicted 375
9 SASI_Hs02_00331668 predicted 406
10 SASI_Hs02_00331669 predicted 273
11 SASI_Hs01_00222792 predicted 394
12 SASI_Hs01_00222797 predicted 406
13 SASI_Hs01_00222798 predicted 398
14 SASI_Hs01_00222799 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039952 predicted 382
2 SASI_Rn01_00039953 predicted 430
3 SASI_Rn01_00039954 predicted 279
4 SASI_Rn01_00039955 predicted 239
5 SASI_Rn01_00039956 predicted 238
6 SASI_Rn02_00268389 predicted 243
7 SASI_Rn01_00039957 predicted 388
8 SASI_Rn02_00268390 predicted 284
9 SASI_Rn01_00039958 predicted 216
10 SASI_Rn01_00039959 predicted 410
11 SASI_Rn01_00039960 predicted 403
12 SASI_Rn01_00039961 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307488 predicted 365
2 SASI_Mm02_00307489 predicted 406
3 SASI_Mm02_00307490 predicted 360
4 SASI_Mm02_00307491 predicted 267
5 SASI_Mm02_00307492 predicted 331
6 SASI_Mm02_00307493 predicted 218
7 SASI_Mm02_00307494 predicted 394
8 SASI_Mm02_00307495 predicted 391
9 SASI_Mm02_00307496 predicted 430
10 SASI_Mm02_00307497 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317620 predicted 547
2 SASI_Mm02_00317621 predicted 478
3 SASI_Mm02_00317622 predicted 502
4 SASI_Mm02_00317623 predicted 612
5 SASI_Mm01_00096839 predicted 406
6 SASI_Mm01_00096842 predicted 357
7 SASI_Mm02_00317624 predicted 586
8 SASI_Mm02_00317625 predicted 581
9 SASI_Mm02_00317626 predicted 602
10 SASI_Mm02_00317627 predicted 444
11 SASI_Mm01_00096838 predicted 370
12 SASI_Mm01_00096840 predicted 368
13 SASI_Mm01_00096841 predicted 347
14 SASI_Mm01_00096843 predicted 212
15 SASI_Mm01_00096844 predicted 381
16 SASI_Mm01_00096845 predicted 278
17 SASI_Mm01_00096846 predicted 372
18 SASI_Mm01_00096847 predicted 341
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001344
VALIDATED
DAD1 MISSION shRNA Bacterial Glycerol Stock
defender against cell death 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-458s1c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-271s1c1
Sequence:CCGGCTAGCGGTTTGCCTGAGAATACTCGAGTATTCTCAGGCAAACCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-378s1c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-300s1c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-96s1c1
Sequence:CCGGGCGGTTCTTAGAAGAGTACTTCTCGAGAAGTACTCTTCTAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-162s21c1
Sequence:CCGGGACGCGTACCTGCTGTATATACTCGAGTATATACAGCAGGTACGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-415s21c1
Sequence:CCGGTTGGCTGACTCATTCTCATTTCTCGAGAAATGAGAATGAGTCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-392s21c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-314s21c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-472s21c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001344
VALIDATED
DAD1 MISSION shRNA shRNA Plasmid DNA
defender against cell death 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-458s1c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-271s1c1
Sequence:CCGGCTAGCGGTTTGCCTGAGAATACTCGAGTATTCTCAGGCAAACCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-378s1c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-300s1c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-96s1c1
Sequence:CCGGGCGGTTCTTAGAAGAGTACTTCTCGAGAAGTACTCTTCTAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-162s21c1
Sequence:CCGGGACGCGTACCTGCTGTATATACTCGAGTATATACAGCAGGTACGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-415s21c1
Sequence:CCGGTTGGCTGACTCATTCTCATTTCTCGAGAAATGAGAATGAGTCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-392s21c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-314s21c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-472s21c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001344
VALIDATED
DAD1 MISSION shRNA Lentiviral Transduction Particles
defender against cell death 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-458s1c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-271s1c1
Sequence:CCGGCTAGCGGTTTGCCTGAGAATACTCGAGTATTCTCAGGCAAACCGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-378s1c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-300s1c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001344.1-96s1c1
Sequence:CCGGGCGGTTCTTAGAAGAGTACTTCTCGAGAAGTACTCTTCTAAGAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-162s21c1
Sequence:CCGGGACGCGTACCTGCTGTATATACTCGAGTATATACAGCAGGTACGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-415s21c1
Sequence:CCGGTTGGCTGACTCATTCTCATTTCTCGAGAAATGAGAATGAGTCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-392s21c1
Sequence:CCGGGCACCTTGTTGTCATGAACTTCTCGAGAAGTTCATGACAACAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-314s21c1
Sequence:CCGGCCCACAGAACAAAGCGGATTTCTCGAGAAATCCGCTTTGTTCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001344.2-472s21c1
Sequence:CCGGCTCTTTGAATTTCCTGGATAACTCGAGTTATCCAGGAAATTCAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010015
VALIDATED
DAD1 MISSION shRNA Bacterial Glycerol Stock
defender against cell death 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-376s1c1
Sequence:CCGGCCGTTTCCTTACTGTGGAGTTCTCGAGAACTCCACAGTAAGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010015.1-234s1c1
Sequence:CCGGCCTAGCGGTTTGCCTGAGAATCTCGAGATTCTCAGGCAAACCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-224s1c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-109s1c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-112s1c1
Sequence:CCGGGACGCCTATCTCCTTTATATACTCGAGTATATAAAGGAGATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010015.4-861s21c1
Sequence:CCGGAGGACCAGATGGGTAACATTCCTCGAGGAATGTTACCCATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-281s21c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-166s21c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-396s21c1
Sequence:CCGGCCTGCACCTTGTCGTCATGAACTCGAGTTCATGACGACAAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-119s21c1
Sequence:CCGGGGTTCCTGGAGGAGTACTTGACTCGAGTCAAGTACTCCTCCAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010015
VALIDATED
DAD1 MISSION shRNA shRNA Plasmid DNA
defender against cell death 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-376s1c1
Sequence:CCGGCCGTTTCCTTACTGTGGAGTTCTCGAGAACTCCACAGTAAGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010015.1-234s1c1
Sequence:CCGGCCTAGCGGTTTGCCTGAGAATCTCGAGATTCTCAGGCAAACCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-224s1c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-109s1c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-112s1c1
Sequence:CCGGGACGCCTATCTCCTTTATATACTCGAGTATATAAAGGAGATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010015.4-861s21c1
Sequence:CCGGAGGACCAGATGGGTAACATTCCTCGAGGAATGTTACCCATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-281s21c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-166s21c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-396s21c1
Sequence:CCGGCCTGCACCTTGTCGTCATGAACTCGAGTTCATGACGACAAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-119s21c1
Sequence:CCGGGGTTCCTGGAGGAGTACTTGACTCGAGTCAAGTACTCCTCCAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010015
VALIDATED
DAD1 MISSION shRNA Lentiviral Transduction Particles
defender against cell death 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093699    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-376s1c1
Sequence:CCGGCCGTTTCCTTACTGTGGAGTTCTCGAGAACTCCACAGTAAGGAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010015.1-234s1c1
Sequence:CCGGCCTAGCGGTTTGCCTGAGAATCTCGAGATTCTCAGGCAAACCGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-224s1c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-109s1c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010015.1-112s1c1
Sequence:CCGGGACGCCTATCTCCTTTATATACTCGAGTATATAAAGGAGATAGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010015.4-861s21c1
Sequence:CCGGAGGACCAGATGGGTAACATTCCTCGAGGAATGTTACCCATCTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-281s21c1
Sequence:CCGGGCAGCTTCATCCTAGCGGTTTCTCGAGAAACCGCTAGGATGAAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-166s21c1
Sequence:CCGGCTGGACGCCTATCTCCTTTATCTCGAGATAAAGGAGATAGGCGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-396s21c1
Sequence:CCGGCCTGCACCTTGTCGTCATGAACTCGAGTTCATGACGACAAGGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010015.4-119s21c1
Sequence:CCGGGGTTCCTGGAGGAGTACTTGACTCGAGTCAAGTACTCCTCCAGGAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks