EMAIL THIS PAGE TO A FRIEND

DAGLA

diacylglycerol lipase, alpha

Synonyms: C11orf11 DAGL(ALPHA) DAGLALPHA NSDDR
UniProtKB ID: Q9Y4D2, A7E233, Q6WQJ0
Gene ID:
Human(747) Summary: This gene encodes a diacylglycerol lipase. The encoded enzyme is involved in the biosynthesis of the endocannabinoid 2-arachidonoyl-glycerol.[provided by RefSeq, Nov 2010]
Mouse(269060) diacylglycerol lipase, alpha
Rat(309207) diacylglycerol lipase, alpha
sheep(101109927) diacylglycerol lipase, alpha
Domestic Rabbit(100342661) diacylglycerol lipase, alpha
domestic guinea pig(100725015) diacylglycerol lipase, alpha
naked mole-rat(101702101) diacylglycerol lipase, alpha
Zebrafish(569398) diacylglycerol lipase, alpha
chicken(426017) diacylglycerol lipase, alpha
cow(523665) diacylglycerol lipase, alpha
domestic cat(101082946) diacylglycerol lipase, alpha
dog(483795) diacylglycerol lipase, alpha
212 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006133 Rosetta Predictions human pricing
NM_001005886 Rosetta Predictions rat pricing
XM_579147 Rosetta Predictions rat pricing
NM_198114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019462 predicted 2549
2 SASI_Hs01_00019463 predicted 970
3 SASI_Hs01_00019464 predicted 1023
4 SASI_Hs01_00019465 predicted 793
5 SASI_Hs01_00019466 predicted 1134
6 SASI_Hs02_00340962 predicted 931
7 SASI_Hs01_00019467 predicted 1393
8 SASI_Hs01_00019468 predicted 2013
9 SASI_Hs01_00019469 predicted 1153
10 SASI_Hs01_00019470 predicted 944
11 SASI_Hs01_00019471 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00092393 predicted 1999
2 SASI_Rn01_00092394 predicted 1207
3 SASI_Rn01_00092395 predicted 773
4 SASI_Rn01_00092396 predicted 1484
5 SASI_Rn01_00092397 predicted 1847
6 SASI_Rn01_00092399 predicted 2359
7 SASI_Rn01_00092400 predicted 730
8 SASI_Rn01_00092401 predicted 1917
9 SASI_Rn01_00092402 predicted 622
10 SASI_Rn02_00198471 predicted 2971
11 SASI_Rn01_00092398 predicted 1133
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00182546 predicted 2003
2 SASI_Rn01_00182547 predicted 1214
3 SASI_Rn01_00182548 predicted 776
4 SASI_Rn01_00182549 predicted 1484
5 SASI_Rn01_00182550 predicted 1852
6 SASI_Rn01_00182551 predicted 1124
7 SASI_Rn01_00182552 predicted 2363
8 SASI_Rn01_00182553 predicted 733
9 SASI_Rn01_00182554 predicted 1920
10 SASI_Rn01_00182555 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350861 predicted 727
2 SASI_Mm01_00164282 predicted 1613
3 SASI_Mm01_00164283 predicted 1492
4 SASI_Mm01_00164284 predicted 1182
5 SASI_Mm02_00350862 predicted 954
6 SASI_Mm01_00164286 predicted 2976
7 SASI_Mm01_00164287 predicted 710
8 SASI_Mm02_00350863 predicted 985
9 SASI_Mm02_00350864 predicted 313
10 SASI_Mm01_00164288 predicted 960
11 SASI_Mm01_00164281 predicted 2541
12 SASI_Mm01_00164285 predicted 2539
13 SASI_Mm01_00164289 predicted 1081
14 SASI_Mm01_00164290 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006133
DAGLA MISSION shRNA Bacterial Glycerol Stock
diacylglycerol lipase, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1228s21c1
Sequence:CCGGTGCCATGATGCGGTCTATGAACTCGAGTTCATAGACCGCATCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-803s1c1
Sequence:CCGGTTGTGCCATCCGACATCATTGCTCGAGCAATGATGTCGGATGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-1202s1c1
Sequence:CCGGCTGCGGTGGACATCGTCTATACTCGAGTATAGACGATGTCCACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1577s21c1
Sequence:CCGGATCCGACCCTCAAGTGCTTTGCTCGAGCAAAGCACTTGAGGGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-2006s21c1
Sequence:CCGGGCGACAACAAGGCCTTCAATGCTCGAGCATTGAAGGCCTTGTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-742s1c1
Sequence:CCGGCAGTCAGATGCCTACTCAGAACTCGAGTTCTGAGTAGGCATCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-504s1c1
Sequence:CCGGCAAGAATGTCACCCTCGGAATCTCGAGATTCCGAGGGTGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006133.1-5091s1c1
Sequence:CCGGCAAGACAGACTCTCAGATGAACTCGAGTTCATCTGAGAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006133
DAGLA MISSION shRNA shRNA Plasmid DNA
diacylglycerol lipase, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1228s21c1
Sequence:CCGGTGCCATGATGCGGTCTATGAACTCGAGTTCATAGACCGCATCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-803s1c1
Sequence:CCGGTTGTGCCATCCGACATCATTGCTCGAGCAATGATGTCGGATGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-1202s1c1
Sequence:CCGGCTGCGGTGGACATCGTCTATACTCGAGTATAGACGATGTCCACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1577s21c1
Sequence:CCGGATCCGACCCTCAAGTGCTTTGCTCGAGCAAAGCACTTGAGGGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-2006s21c1
Sequence:CCGGGCGACAACAAGGCCTTCAATGCTCGAGCATTGAAGGCCTTGTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-742s1c1
Sequence:CCGGCAGTCAGATGCCTACTCAGAACTCGAGTTCTGAGTAGGCATCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-504s1c1
Sequence:CCGGCAAGAATGTCACCCTCGGAATCTCGAGATTCCGAGGGTGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006133.1-5091s1c1
Sequence:CCGGCAAGACAGACTCTCAGATGAACTCGAGTTCATCTGAGAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006133
DAGLA MISSION shRNA Lentiviral Transduction Particles
diacylglycerol lipase, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1228s21c1
Sequence:CCGGTGCCATGATGCGGTCTATGAACTCGAGTTCATAGACCGCATCATGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-803s1c1
Sequence:CCGGTTGTGCCATCCGACATCATTGCTCGAGCAATGATGTCGGATGGCACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-1202s1c1
Sequence:CCGGCTGCGGTGGACATCGTCTATACTCGAGTATAGACGATGTCCACCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-1577s21c1
Sequence:CCGGATCCGACCCTCAAGTGCTTTGCTCGAGCAAAGCACTTGAGGGTCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006133.1-2006s21c1
Sequence:CCGGGCGACAACAAGGCCTTCAATGCTCGAGCATTGAAGGCCTTGTTGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-742s1c1
Sequence:CCGGCAGTCAGATGCCTACTCAGAACTCGAGTTCTGAGTAGGCATCTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006133.1-504s1c1
Sequence:CCGGCAAGAATGTCACCCTCGGAATCTCGAGATTCCGAGGGTGACATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127672    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006133.1-5091s1c1
Sequence:CCGGCAAGACAGACTCTCAGATGAACTCGAGTTCATCTGAGAGTCTGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198114
VALIDATED
DAGLA MISSION shRNA Bacterial Glycerol Stock
diacylglycerol lipase, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-1996s21c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198114.2-4945s1c1
Sequence:CCGGCTGGTTCTTAGAACTCAAATACTCGAGTATTTGAGTTCTAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.2-1996s1c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-217s21c1
Sequence:CCGGGCTCTTCGGCTTGGTCTATAACTCGAGTTATAGACCAAGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-951s21c1
Sequence:CCGGACGAGATGCTACGCTACAAAGCTCGAGCTTTGTAGCGTAGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-302s21c1
Sequence:CCGGAGCTGTATGATTGCCGAAATGCTCGAGCATTTCGGCAATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-4946s21c1
Sequence:CCGGTGGTTCTTAGAACTCAAATATCTCGAGATATTTGAGTTCTAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-2751s1c1
Sequence:CCGGGTTCATTGACAGCCTCTTCAACTCGAGTTGAAGAGGCTGTCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-210s1c1
Sequence:CCGGGATTGCCGAAATGGCTATCATCTCGAGATGATAGCCATTTCGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-853s1c1
Sequence:CCGGGAGATGCTACGCTACAAAGAACTCGAGTTCTTTGTAGCGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198114
VALIDATED
DAGLA MISSION shRNA shRNA Plasmid DNA
diacylglycerol lipase, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-1996s21c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198114.2-4945s1c1
Sequence:CCGGCTGGTTCTTAGAACTCAAATACTCGAGTATTTGAGTTCTAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.2-1996s1c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-217s21c1
Sequence:CCGGGCTCTTCGGCTTGGTCTATAACTCGAGTTATAGACCAAGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-951s21c1
Sequence:CCGGACGAGATGCTACGCTACAAAGCTCGAGCTTTGTAGCGTAGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-302s21c1
Sequence:CCGGAGCTGTATGATTGCCGAAATGCTCGAGCATTTCGGCAATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-4946s21c1
Sequence:CCGGTGGTTCTTAGAACTCAAATATCTCGAGATATTTGAGTTCTAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-2751s1c1
Sequence:CCGGGTTCATTGACAGCCTCTTCAACTCGAGTTGAAGAGGCTGTCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-210s1c1
Sequence:CCGGGATTGCCGAAATGGCTATCATCTCGAGATGATAGCCATTTCGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-853s1c1
Sequence:CCGGGAGATGCTACGCTACAAAGAACTCGAGTTCTTTGTAGCGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198114
VALIDATED
DAGLA MISSION shRNA Lentiviral Transduction Particles
diacylglycerol lipase, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-1996s21c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216286    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198114.2-4945s1c1
Sequence:CCGGCTGGTTCTTAGAACTCAAATACTCGAGTATTTGAGTTCTAAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217749    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.2-1996s1c1
Sequence:CCGGGGGCGACAATAAAGCCTTTAACTCGAGTTAAAGGCTTTATTGTCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-217s21c1
Sequence:CCGGGCTCTTCGGCTTGGTCTATAACTCGAGTTATAGACCAAGCCGAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-951s21c1
Sequence:CCGGACGAGATGCTACGCTACAAAGCTCGAGCTTTGTAGCGTAGCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-302s21c1
Sequence:CCGGAGCTGTATGATTGCCGAAATGCTCGAGCATTTCGGCAATCATACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198114.2-4946s21c1
Sequence:CCGGTGGTTCTTAGAACTCAAATATCTCGAGATATTTGAGTTCTAAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198909    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-2751s1c1
Sequence:CCGGGTTCATTGACAGCCTCTTCAACTCGAGTTGAAGAGGCTGTCAATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181764    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-210s1c1
Sequence:CCGGGATTGCCGAAATGGCTATCATCTCGAGATGATAGCCATTTCGGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181646    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198114.1-853s1c1
Sequence:CCGGGAGATGCTACGCTACAAAGAACTCGAGTTCTTTGTAGCGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks