EMAIL THIS PAGE TO A FRIEND

DAGLB

diacylglycerol lipase, beta

46 Gene Product Result for
Synonyms: DAGLBETA KCCR13L
Gene ID:
Mouse(231871) diacylglycerol lipase, beta
Rat(304289) diacylglycerol lipase, beta
Zebrafish(565287) diacylglycerol lipase, beta
chicken(416625) diacylglycerol lipase, beta
cow(538021) diacylglycerol lipase, beta
Horse(100061701) diacylglycerol lipase, beta
domestic cat(101101020) diacylglycerol lipase, beta
dog(479756) diacylglycerol lipase, beta
naked mole-rat(101707060) diacylglycerol lipase, beta
domestic guinea pig(100727672) diacylglycerol lipase, beta
sheep(101105875) diacylglycerol lipase, beta
Domestic Rabbit(100339619) diacylglycerol lipase, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303711 ANTI-DAGLB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, western blot pricing
SAB2100528 Anti-DAGLB antibody produced in rabbit affinity isolated antibody horse, mouse, guinea pig, rat, human, rabbit, bovine, canine
western blot pricing
HPA069377 Anti-DAGLB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144915 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144915 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144915 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139179 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012441 MISSION® esiRNA esiRNA targeting human DAGLB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_139179 Rosetta Predictions human pricing
NM_001107120 Rosetta Predictions rat pricing
NM_144915 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092157 predicted 1343
2 SASI_Hs01_00092158 predicted 1359
3 SASI_Hs01_00092159 predicted 673
4 SASI_Hs01_00092160 predicted 1322
5 SASI_Hs01_00092161 predicted 1159
6 SASI_Hs01_00092162 predicted 382
7 SASI_Hs01_00092163 predicted 791
8 SASI_Hs01_00092164 predicted 275
9 SASI_Hs01_00092165 predicted 275
10 SASI_Hs01_00092166 predicted 955
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225696 predicted 1108
2 SASI_Rn02_00225697 predicted 1502
3 SASI_Rn02_00225698 predicted 601
4 SASI_Rn02_00225699 predicted 1348
5 SASI_Rn02_00225700 predicted 1700
6 SASI_Rn02_00225701 predicted 1618
7 SASI_Rn02_00225702 predicted 359
8 SASI_Rn02_00225703 predicted 590
9 SASI_Rn02_00225704 predicted 517
10 SASI_Rn02_00225705 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144915 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145447 predicted 390
2 SASI_Mm01_00145448 predicted 1251
3 SASI_Mm02_00340397 predicted 342
4 SASI_Mm01_00145449 predicted 1221
5 SASI_Mm01_00145450 predicted 1223
6 SASI_Mm01_00145451 predicted 1616
7 SASI_Mm02_00340398 predicted 312
8 SASI_Mm01_00145452 predicted 1606
9 SASI_Mm01_00145453 predicted 462
10 SASI_Mm01_00145454 predicted 1246
11 SASI_Mm01_00145445 predicted 1599
12 SASI_Mm01_00145446 predicted 1580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144915
DAGLB MISSION shRNA Bacterial Glycerol Stock
diacylglycerol lipase, beta
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000178565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-840s1c1
Sequence:CCGGCCTCAGGAAACTGAGTTAGATCTCGAGATCTAACTCAGTTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-283s1c1
Sequence:CCGGGCATGAGAGGAACCATTTGTACTCGAGTACAAATGGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144915.2-2617s1c1
Sequence:CCGGCTGAACTTTAAGACAACAGATCTCGAGATCTGTTGTCTTAAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-981s1c1
Sequence:CCGGGCCAGAGACATAGAGTACGATCTCGAGATCGTACTCTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144915
DAGLB MISSION shRNA shRNA Plasmid DNA
diacylglycerol lipase, beta
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000178565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-840s1c1
Sequence:CCGGCCTCAGGAAACTGAGTTAGATCTCGAGATCTAACTCAGTTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-283s1c1
Sequence:CCGGGCATGAGAGGAACCATTTGTACTCGAGTACAAATGGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144915.2-2617s1c1
Sequence:CCGGCTGAACTTTAAGACAACAGATCTCGAGATCTGTTGTCTTAAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-981s1c1
Sequence:CCGGGCCAGAGACATAGAGTACGATCTCGAGATCGTACTCTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144915
DAGLB MISSION shRNA Lentiviral Transduction Particles
diacylglycerol lipase, beta
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000178565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-840s1c1
Sequence:CCGGCCTCAGGAAACTGAGTTAGATCTCGAGATCTAACTCAGTTTCCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-283s1c1
Sequence:CCGGGCATGAGAGGAACCATTTGTACTCGAGTACAAATGGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144915.2-2617s1c1
Sequence:CCGGCTGAACTTTAAGACAACAGATCTCGAGATCTGTTGTCTTAAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144915.2-981s1c1
Sequence:CCGGGCCAGAGACATAGAGTACGATCTCGAGATCGTACTCTATGTCTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139179
VALIDATED
DAGLB MISSION shRNA Bacterial Glycerol Stock
diacylglycerol lipase, beta
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1699s1c1
Sequence:CCGGCGGTTTGTGGTACGAACTGTTCTCGAGAACAGTTCGTACCACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-648s1c1
Sequence:CCGGGCCAGTTACTTAATGGCCTCACTCGAGTGAGGCCATTAAGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-1346s1c1
Sequence:CCGGGCCAGATACGTTTACCAACGACTCGAGTCGTTGGTAAACGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1343s1c1
Sequence:CCGGGCTGCCAGATACGTTTACCAACTCGAGTTGGTAAACGTATCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-493s1c1
Sequence:CCGGGACAGTTGTAAACGGCATCATCTCGAGATGATGCCGTTTACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-2227s1c1
Sequence:CCGGCGAATGTCCATCAACAGGAATCTCGAGATTCCTGTTGATGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-351s1c1
Sequence:CCGGGCATGAGAGGAACGATTTGTACTCGAGTACAAATCGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1712s21c1
Sequence:CCGGAGTGGTCGCGCACTGCAATAACTCGAGTTATTGCAGTGCGCGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2322s21c1
Sequence:CCGGTCCATGGTCTCAATGACTTAACTCGAGTTAAGTCATTGAGACCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1375s21c1
Sequence:CCGGGCCTGGCACACAAGGGTATTTCTCGAGAAATACCCTTGTGTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1423s21c1
Sequence:CCGGGACTCATCAACGACGGGATTTCTCGAGAAATCCCGTCGTTGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2610s21c1
Sequence:CCGGGGGCTTCCTGGATGTACAAATCTCGAGATTTGTACATCCAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2523s21c1
Sequence:CCGGAGACCGTGAACAGTTCCTTAGCTCGAGCTAAGGAACTGTTCACGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-741s21c1
Sequence:CCGGAGCGTGTGGGAAACCAGAATCCTCGAGGATTCTGGTTTCCCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139179
VALIDATED
DAGLB MISSION shRNA shRNA Plasmid DNA
diacylglycerol lipase, beta
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1699s1c1
Sequence:CCGGCGGTTTGTGGTACGAACTGTTCTCGAGAACAGTTCGTACCACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-648s1c1
Sequence:CCGGGCCAGTTACTTAATGGCCTCACTCGAGTGAGGCCATTAAGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-1346s1c1
Sequence:CCGGGCCAGATACGTTTACCAACGACTCGAGTCGTTGGTAAACGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1343s1c1
Sequence:CCGGGCTGCCAGATACGTTTACCAACTCGAGTTGGTAAACGTATCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-493s1c1
Sequence:CCGGGACAGTTGTAAACGGCATCATCTCGAGATGATGCCGTTTACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-2227s1c1
Sequence:CCGGCGAATGTCCATCAACAGGAATCTCGAGATTCCTGTTGATGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-351s1c1
Sequence:CCGGGCATGAGAGGAACGATTTGTACTCGAGTACAAATCGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1712s21c1
Sequence:CCGGAGTGGTCGCGCACTGCAATAACTCGAGTTATTGCAGTGCGCGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2322s21c1
Sequence:CCGGTCCATGGTCTCAATGACTTAACTCGAGTTAAGTCATTGAGACCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1375s21c1
Sequence:CCGGGCCTGGCACACAAGGGTATTTCTCGAGAAATACCCTTGTGTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1423s21c1
Sequence:CCGGGACTCATCAACGACGGGATTTCTCGAGAAATCCCGTCGTTGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2610s21c1
Sequence:CCGGGGGCTTCCTGGATGTACAAATCTCGAGATTTGTACATCCAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2523s21c1
Sequence:CCGGAGACCGTGAACAGTTCCTTAGCTCGAGCTAAGGAACTGTTCACGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-741s21c1
Sequence:CCGGAGCGTGTGGGAAACCAGAATCCTCGAGGATTCTGGTTTCCCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139179
VALIDATED
DAGLB MISSION shRNA Lentiviral Transduction Particles
diacylglycerol lipase, beta
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1699s1c1
Sequence:CCGGCGGTTTGTGGTACGAACTGTTCTCGAGAACAGTTCGTACCACAAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-648s1c1
Sequence:CCGGGCCAGTTACTTAATGGCCTCACTCGAGTGAGGCCATTAAGTAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_139179.1-1346s1c1
Sequence:CCGGGCCAGATACGTTTACCAACGACTCGAGTCGTTGGTAAACGTATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_139179.1-1343s1c1
Sequence:CCGGGCTGCCAGATACGTTTACCAACTCGAGTTGGTAAACGTATCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-493s1c1
Sequence:CCGGGACAGTTGTAAACGGCATCATCTCGAGATGATGCCGTTTACAACTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154315    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-2227s1c1
Sequence:CCGGCGAATGTCCATCAACAGGAATCTCGAGATTCCTGTTGATGGACATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_139179.1-351s1c1
Sequence:CCGGGCATGAGAGGAACGATTTGTACTCGAGTACAAATCGTTCCTCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1712s21c1
Sequence:CCGGAGTGGTCGCGCACTGCAATAACTCGAGTTATTGCAGTGCGCGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419594    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2322s21c1
Sequence:CCGGTCCATGGTCTCAATGACTTAACTCGAGTTAAGTCATTGAGACCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1375s21c1
Sequence:CCGGGCCTGGCACACAAGGGTATTTCTCGAGAAATACCCTTGTGTGCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-1423s21c1
Sequence:CCGGGACTCATCAACGACGGGATTTCTCGAGAAATCCCGTCGTTGATGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428432    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2610s21c1
Sequence:CCGGGGGCTTCCTGGATGTACAAATCTCGAGATTTGTACATCCAGGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430205    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_139179.3-2523s21c1
Sequence:CCGGAGACCGTGAACAGTTCCTTAGCTCGAGCTAAGGAACTGTTCACGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139179.3-741s21c1
Sequence:CCGGAGCGTGTGGGAAACCAGAATCCTCGAGGATTCTGGTTTCCCACACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks