EMAIL THIS PAGE TO A FRIEND

DAK

dihydroxyacetone kinase 2 homolog (S. cerevisiae)

59 Gene Product Result for
Synonyms: NET45
UniProtKB ID: Q3LXA3, Q53EQ9, Q9BVA7, Q9H895
Gene ID:
Human(26007) Summary: This gene is a member of the family of dihydroxyacetone kinases, which have a protein structure distinct from other kinases. The product of this gene phosphorylates dihydroxyacetone, and also catalyzes the formation of riboflavin 4',5'-phosphate (aka cyclin FMN) from FAD. Several alternatively spliced transcript variants have been identified, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(225913) dihydroxyacetone kinase 2 homolog (yeast)
Rat(361730) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Zebrafish(793926) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
chicken(426629) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Horse(100059639) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
cow(512373) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
domestic cat(101081330) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
dog(483800) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
sheep(101106378) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Domestic Rabbit(100344187) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
domestic guinea pig(100727199) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
naked mole-rat(101710604) dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145496 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145496 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145496 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015533 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090671 MISSION® esiRNA esiRNA human DAK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015533 Rosetta Predictions human pricing
NM_001039031 Rosetta Predictions rat pricing
NM_145496 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225045 predicted 2320
2 SASI_Hs01_00225046 predicted 2285
3 SASI_Hs02_00348050 predicted 2477
4 SASI_Hs01_00225048 predicted 2472
5 SASI_Hs01_00225049 predicted 2363
6 SASI_Hs01_00225050 predicted 1731
7 SASI_Hs01_00225051 predicted 372
8 SASI_Hs01_00225052 predicted 1032
9 SASI_Hs02_00348051 predicted 2102
10 SASI_Hs02_00348052 predicted 1577
11 SASI_Hs01_00225047 predicted 1238
12 SASI_Hs01_00225053 predicted 2397
13 SASI_Hs01_00225054 predicted 1608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039031 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116544 predicted 1660
2 SASI_Rn01_00116545 predicted 886
3 SASI_Rn01_00116546 predicted 1398
4 SASI_Rn01_00116547 predicted 1756
5 SASI_Rn01_00116548 predicted 1190
6 SASI_Rn01_00116549 predicted 981
7 SASI_Rn01_00116550 predicted 1072
8 SASI_Rn01_00116551 predicted 742
9 SASI_Rn01_00116552 predicted 957
10 SASI_Rn01_00116553 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145496 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160932 predicted 1466
2 SASI_Mm01_00160933 predicted 1187
3 SASI_Mm01_00160935 predicted 824
4 SASI_Mm01_00160936 predicted 1056
5 SASI_Mm01_00160937 predicted 1286
6 SASI_Mm01_00160938 predicted 803
7 SASI_Mm01_00160939 predicted 879
8 SASI_Mm01_00160940 predicted 788
9 SASI_Mm01_00160941 predicted 1640
10 SASI_Mm02_00340940 predicted 402
11 SASI_Mm01_00160934 predicted 840
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145496
DAK MISSION shRNA Bacterial Glycerol Stock
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-757s21c1
Sequence:CCGGAGCTGGTGTTCGTCGGATAAACTCGAGTTTATCCGACGAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145496.1-2082s21c1
Sequence:CCGGCTAACTGGGTATACCCATTTCCTCGAGGAAATGGGTATACCCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-1706s21c1
Sequence:CCGGGGTGCTGGGAGAGCTAGTTATCTCGAGATAACTAGCTCTCCCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1052s1c1
Sequence:CCGGCCCGTGCTGAAGCTAATAGATCTCGAGATCTATTAGCTTCAGCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1015s1c1
Sequence:CCGGGCCTGGTGTGTCTCTTACTTTCTCGAGAAAGTAAGAGACACACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-817s1c1
Sequence:CCGGCCACATGACAAACACCTCCAACTCGAGTTGGAGGTGTTTGTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-433s1c1
Sequence:CCGGGCTCAACTTTGGACTTGCCATCTCGAGATGGCAAGTCCAAAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1707s1c1
Sequence:CCGGGTGCTGGGAGAGCTAGTTATACTCGAGTATAACTAGCTCTCCCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145496
DAK MISSION shRNA shRNA Plasmid DNA
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-757s21c1
Sequence:CCGGAGCTGGTGTTCGTCGGATAAACTCGAGTTTATCCGACGAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145496.1-2082s21c1
Sequence:CCGGCTAACTGGGTATACCCATTTCCTCGAGGAAATGGGTATACCCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-1706s21c1
Sequence:CCGGGGTGCTGGGAGAGCTAGTTATCTCGAGATAACTAGCTCTCCCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1052s1c1
Sequence:CCGGCCCGTGCTGAAGCTAATAGATCTCGAGATCTATTAGCTTCAGCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1015s1c1
Sequence:CCGGGCCTGGTGTGTCTCTTACTTTCTCGAGAAAGTAAGAGACACACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-817s1c1
Sequence:CCGGCCACATGACAAACACCTCCAACTCGAGTTGGAGGTGTTTGTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-433s1c1
Sequence:CCGGGCTCAACTTTGGACTTGCCATCTCGAGATGGCAAGTCCAAAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1707s1c1
Sequence:CCGGGTGCTGGGAGAGCTAGTTATACTCGAGTATAACTAGCTCTCCCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145496
DAK MISSION shRNA Lentiviral Transduction Particles
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-757s21c1
Sequence:CCGGAGCTGGTGTTCGTCGGATAAACTCGAGTTTATCCGACGAACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368827    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145496.1-2082s21c1
Sequence:CCGGCTAACTGGGTATACCCATTTCCTCGAGGAAATGGGTATACCCAGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145496.1-1706s21c1
Sequence:CCGGGGTGCTGGGAGAGCTAGTTATCTCGAGATAACTAGCTCTCCCAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1052s1c1
Sequence:CCGGCCCGTGCTGAAGCTAATAGATCTCGAGATCTATTAGCTTCAGCACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1015s1c1
Sequence:CCGGGCCTGGTGTGTCTCTTACTTTCTCGAGAAAGTAAGAGACACACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-817s1c1
Sequence:CCGGCCACATGACAAACACCTCCAACTCGAGTTGGAGGTGTTTGTCATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-433s1c1
Sequence:CCGGGCTCAACTTTGGACTTGCCATCTCGAGATGGCAAGTCCAAAGTTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145496.1-1707s1c1
Sequence:CCGGGTGCTGGGAGAGCTAGTTATACTCGAGTATAACTAGCTCTCCCAGCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015533
VALIDATED
DAK MISSION shRNA Bacterial Glycerol Stock
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-1221s21c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-569s21c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015533.3-2102s21c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-986s21c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1896s1c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-363s1c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-780s1c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1015s1c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015533.2-1597s1c1
Sequence:CCGGCTGTTACAAGTCCTGACCAAACTCGAGTTTGGTCAGGACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015533
VALIDATED
DAK MISSION shRNA shRNA Plasmid DNA
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-1221s21c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-569s21c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015533.3-2102s21c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-986s21c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1896s1c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-363s1c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-780s1c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1015s1c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015533.2-1597s1c1
Sequence:CCGGCTGTTACAAGTCCTGACCAAACTCGAGTTTGGTCAGGACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015533
VALIDATED
DAK MISSION shRNA Lentiviral Transduction Particles
dihydroxyacetone kinase 2 homolog (S. cerevisiae)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-1221s21c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-569s21c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015533.3-2102s21c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015533.3-986s21c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1896s1c1
Sequence:CCGGCCCTCTAAGTTGAGCAGGAAACTCGAGTTTCCTGCTCAACTTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-363s1c1
Sequence:CCGGGCTCCTTATCGTGAAGAACTACTCGAGTAGTTCTTCACGATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-780s1c1
Sequence:CCGGCCACATGACAAACACCACCAACTCGAGTTGGTGGTGTTTGTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015533.2-1015s1c1
Sequence:CCGGCCTCTCCTGAAACTGATAGATCTCGAGATCTATCAGTTTCAGGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015533.2-1597s1c1
Sequence:CCGGCTGTTACAAGTCCTGACCAAACTCGAGTTTGGTCAGGACTTGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks