EMAIL THIS PAGE TO A FRIEND

DALRD3

DALR anticodon binding domain containing 3

91 Gene Product Result for
UniProtKB ID: Q5D0E6, Q7Z5S7, Q86WY1, Q8N105, Q8NA89, Q9NVU8
Gene ID:
Human(55152) Summary: The exact function of this gene is not known. It encodes a protein with a DALR anticodon binding domain similar to that of class Ia aminoacyl tRNA synthetases. This gene is located in a cluster of genes (with a complex sense-anti-sense genome architecture) on chromosome 3, and contains two micro RNA (miRNA) precursors (mir-425 and mir-191) in one of its introns. Preferential expression of this gene (the miRNAs and other genes in the cluster) in testis suggests a role of this gene in spermatogenesis (PMID:19906709). [provided by RefSeq, Feb 2013]
Mouse(67789) DALR anticodon binding domain containing 3
Rat(363146) DALR anticodon binding domain containing 3
Zebrafish(571036) DALR anticodon binding domain containing 3
domestic cat(101101623) DALR anticodon binding domain containing 3
dog(484772) DALR anticodon binding domain containing 3
chicken(416059) DALR anticodon binding domain containing 3
Horse(100063362) DALR anticodon binding domain containing 3
cow(526885) DALR anticodon binding domain containing 3
naked mole-rat(101698378) DALR anticodon binding domain containing 3
domestic guinea pig(100730021) DALR anticodon binding domain containing 3
sheep(101108782) DALR anticodon binding domain containing 3
Domestic Rabbit(100358357) DALR anticodon binding domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026378 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026378 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026378 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018114 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU133791 MISSION® esiRNA esiRNA human DALRD3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009996 Rosetta Predictions human pricing
NM_018114 Rosetta Predictions human pricing
NM_001014214 Rosetta Predictions rat pricing
NM_026378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009996 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125954 predicted 1092
2 SASI_Hs01_00125955 predicted 1023
3 SASI_Hs01_00125956 predicted 904
4 SASI_Hs01_00125957 predicted 596
5 SASI_Hs01_00125958 predicted 1451
6 SASI_Hs01_00125959 predicted 1201
7 SASI_Hs01_00125960 predicted 1442
8 SASI_Hs01_00125961 predicted 500
9 SASI_Hs01_00125962 predicted 1222
10 SASI_Hs01_00125963 predicted 1942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023520 predicted 1096
2 SASI_Hs01_00023521 predicted 1030
3 SASI_Hs01_00023522 predicted 913
4 SASI_Hs01_00023523 predicted 605
5 SASI_Hs01_00023524 predicted 1456
6 SASI_Hs01_00023525 predicted 1209
7 SASI_Hs01_00023526 predicted 1440
8 SASI_Hs01_00023528 predicted 1229
9 SASI_Hs01_00023529 predicted 1941
10 SASI_Hs02_00351318 predicted 1955
11 SASI_Hs01_00023527 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118986 predicted 1097
2 SASI_Rn01_00118987 predicted 669
3 SASI_Rn01_00118988 predicted 819
4 SASI_Rn01_00118989 predicted 582
5 SASI_Rn02_00201747 predicted 1079
6 SASI_Rn01_00118990 predicted 249
7 SASI_Rn01_00118992 predicted 1079
8 SASI_Rn01_00118994 predicted 1111
9 SASI_Rn01_00118995 predicted 710
10 SASI_Rn02_00201748 predicted 1252
11 SASI_Rn01_00118991 predicted 649
12 SASI_Rn01_00118993 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330115 predicted 824
2 SASI_Mm02_00330116 predicted 888
3 SASI_Mm02_00330117 predicted 842
4 SASI_Mm02_00330118 predicted 263
5 SASI_Mm02_00330119 predicted 656
6 SASI_Mm02_00330120 predicted 596
7 SASI_Mm02_00330121 predicted 1186
8 SASI_Mm02_00330122 predicted 606
9 SASI_Mm02_00330123 predicted 438
10 SASI_Mm02_00330124 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026378
VALIDATED
DALRD3 MISSION shRNA Bacterial Glycerol Stock
DALR anticodon binding domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1269s1c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1237s1c1
Sequence:CCGGACACTCTTCGAGGGCTACAAACTCGAGTTTGTAGCCCTCGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1431s1c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1175s1c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026378.2-1309s1c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-512s21c1
Sequence:CCGGGACCCTCACATGTCAACTTTCCTCGAGGAAAGTTGACATGTGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1313s21c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1435s21c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1179s21c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1273s21c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026378
VALIDATED
DALRD3 MISSION shRNA shRNA Plasmid DNA
DALR anticodon binding domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1269s1c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1237s1c1
Sequence:CCGGACACTCTTCGAGGGCTACAAACTCGAGTTTGTAGCCCTCGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1431s1c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1175s1c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026378.2-1309s1c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-512s21c1
Sequence:CCGGGACCCTCACATGTCAACTTTCCTCGAGGAAAGTTGACATGTGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1313s21c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1435s21c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1179s21c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1273s21c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026378
VALIDATED
DALRD3 MISSION shRNA Lentiviral Transduction Particles
DALR anticodon binding domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1269s1c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1237s1c1
Sequence:CCGGACACTCTTCGAGGGCTACAAACTCGAGTTTGTAGCCCTCGAAGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1431s1c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026378.2-1175s1c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026378.2-1309s1c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-512s21c1
Sequence:CCGGGACCCTCACATGTCAACTTTCCTCGAGGAAAGTTGACATGTGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1313s21c1
Sequence:CCGGGACTTCTCACTACTCCATGATCTCGAGATCATGGAGTAGTGAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1435s21c1
Sequence:CCGGCCGCACGGAGATGGTATGCAACTCGAGTTGCATACCATCTCCGTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1179s21c1
Sequence:CCGGCCATCTCAACAAAGGGCACAACTCGAGTTGTGCCCTTTGTTGAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026378.3-1273s21c1
Sequence:CCGGGCAAGGTCTGTATCCCACTTTCTCGAGAAAGTGGGATACAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018114
DALRD3 MISSION shRNA Bacterial Glycerol Stock
DALR anticodon binding domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-919s1c1
Sequence:CCGGCAGAAGTTGGTTGACAAGGCTCTCGAGAGCCTTGTCAACCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1128s1c1
Sequence:CCGGCACCATCAAGTTTGAGATGCTCTCGAGAGCATCTCAAACTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1256s1c1
Sequence:CCGGCCACACTCTTTGAGAGTTACACTCGAGTGTAACTCTCAAAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-613s1c1
Sequence:CCGGGAAGAACTTACCTCTGCTAATCTCGAGATTAGCAGAGGTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1494s1c1
Sequence:CCGGCATGGATTTCAGCTCCTACTACTCGAGTAGTAGGAGCTGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-854s1c1
Sequence:CCGGGCCTGGTTGTACATGTTGTTACTCGAGTAACAACATGTACAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1450s1c1
Sequence:CCGGGCTGTACGCACAGAGATGATACTCGAGTATCATCTCTGTGCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1100s1c1
Sequence:CCGGCAGAGATCTTTGGTGTTCTCTCTCGAGAGAGAACACCAAAGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018114.4-1955s21c1
Sequence:CCGGCTCAGTCATACCAGTTGTAAACTCGAGTTTACAACTGGTATGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018114.4-1495s21c1
Sequence:CCGGATGGATTTCAGCTCCTACTACCTCGAGGTAGTAGGAGCTGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018114
DALRD3 MISSION shRNA shRNA Plasmid DNA
DALR anticodon binding domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-919s1c1
Sequence:CCGGCAGAAGTTGGTTGACAAGGCTCTCGAGAGCCTTGTCAACCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1128s1c1
Sequence:CCGGCACCATCAAGTTTGAGATGCTCTCGAGAGCATCTCAAACTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1256s1c1
Sequence:CCGGCCACACTCTTTGAGAGTTACACTCGAGTGTAACTCTCAAAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-613s1c1
Sequence:CCGGGAAGAACTTACCTCTGCTAATCTCGAGATTAGCAGAGGTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1494s1c1
Sequence:CCGGCATGGATTTCAGCTCCTACTACTCGAGTAGTAGGAGCTGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-854s1c1
Sequence:CCGGGCCTGGTTGTACATGTTGTTACTCGAGTAACAACATGTACAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1450s1c1
Sequence:CCGGGCTGTACGCACAGAGATGATACTCGAGTATCATCTCTGTGCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1100s1c1
Sequence:CCGGCAGAGATCTTTGGTGTTCTCTCTCGAGAGAGAACACCAAAGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018114.4-1955s21c1
Sequence:CCGGCTCAGTCATACCAGTTGTAAACTCGAGTTTACAACTGGTATGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018114.4-1495s21c1
Sequence:CCGGATGGATTTCAGCTCCTACTACCTCGAGGTAGTAGGAGCTGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018114
DALRD3 MISSION shRNA Lentiviral Transduction Particles
DALR anticodon binding domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155895    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-919s1c1
Sequence:CCGGCAGAAGTTGGTTGACAAGGCTCTCGAGAGCCTTGTCAACCAACTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1128s1c1
Sequence:CCGGCACCATCAAGTTTGAGATGCTCTCGAGAGCATCTCAAACTTGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1256s1c1
Sequence:CCGGCCACACTCTTTGAGAGTTACACTCGAGTGTAACTCTCAAAGAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-613s1c1
Sequence:CCGGGAAGAACTTACCTCTGCTAATCTCGAGATTAGCAGAGGTAAGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152724    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1494s1c1
Sequence:CCGGCATGGATTTCAGCTCCTACTACTCGAGTAGTAGGAGCTGAAATCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-854s1c1
Sequence:CCGGGCCTGGTTGTACATGTTGTTACTCGAGTAACAACATGTACAACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018114.3-1450s1c1
Sequence:CCGGGCTGTACGCACAGAGATGATACTCGAGTATCATCTCTGTGCGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018114.3-1100s1c1
Sequence:CCGGCAGAGATCTTTGGTGTTCTCTCTCGAGAGAGAACACCAAAGATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433530    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018114.4-1955s21c1
Sequence:CCGGCTCAGTCATACCAGTTGTAAACTCGAGTTTACAACTGGTATGACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018114.4-1495s21c1
Sequence:CCGGATGGATTTCAGCTCCTACTACCTCGAGGTAGTAGGAGCTGAAATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks