EMAIL THIS PAGE TO A FRIEND

DAND5

DAN domain family member 5, BMP antagonist

323 Gene Product Result for
Synonyms: CER2 CERL2 CKTSF1B3 COCO CRL2 DANTE GREM3 SP1
UniProtKB ID: Q8N907
Gene ID:
Human(199699) Summary: This gene encodes a member of the BMP (bone morphogenic protein) antagonist family. Like BMPs, BMP antagonists contain cystine knots and typically form homo- and heterodimers. The CAN (cerberus and dan) subfamily of BMP antagonists, to which this gene belongs, is characterized by a C-terminal cystine knot with an eight-membered ring. The antagonistic effect of the secreted protein encoded by this gene is likely due to its direct binding to BMP proteins. As an antagonist of BMP, this gene may play a role in regulating organogenesis, body patterning, and tissue differentiation. In mouse, this protein has been shown to bind Nodal and to inhibit the Nodal signaling pathway which patterns left/right body asymmetry. [provided by RefSeq, Jul 2008]
Mouse(23863) DAN domain family, member 5
Rat(685719) DAN domain family, member 5
domestic guinea pig(100727384) DAN domain family member 5, BMP antagonist
naked mole-rat(101721262) DAN domain family member 5, BMP antagonist
Zebrafish(791454) DAN domain family, member 5
dog(484921) DAN domain family, member 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0643 Human DAND5 / DAN Domain Family Member 5 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201227 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201227 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201227 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU034531 MISSION® esiRNA esiRNA targeting mouse Dand5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152654 Rosetta Predictions human pricing
XM_001064979 Rosetta Predictions rat pricing
NM_201227 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127608 predicted 396
2 SASI_Hs01_00127610 predicted 308
3 SASI_Hs01_00127611 predicted 380
4 SASI_Hs01_00127612 predicted 460
5 SASI_Hs01_00127613 predicted 386
6 SASI_Hs01_00127614 predicted 307
7 SASI_Hs01_00127615 predicted 607
8 SASI_Hs01_00127616 predicted 386
9 SASI_Hs01_00127617 predicted 618
10 SASI_Hs02_00366545 predicted 550
11 SASI_Hs01_00127609 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312432 predicted 258
2 SASI_Rn02_00312433 predicted 328
3 SASI_Rn02_00312434 predicted 245
4 SASI_Rn02_00312435 predicted 287
5 SASI_Rn02_00312436 predicted 274
6 SASI_Rn02_00312437 predicted 332
7 SASI_Rn02_00312438 predicted 296
8 SASI_Rn02_00312439 predicted 334
9 SASI_Rn02_00312440 predicted 297
10 SASI_Rn02_00312441 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201227 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129377 predicted 945
2 SASI_Mm01_00129378 predicted 1111
3 SASI_Mm01_00129379 predicted 652
4 SASI_Mm01_00129380 predicted 839
5 SASI_Mm01_00129381 predicted 740
6 SASI_Mm01_00129382 predicted 853
7 SASI_Mm01_00129383 predicted 798
8 SASI_Mm01_00129384 predicted 1013
9 SASI_Mm02_00351483 predicted 1107
10 SASI_Mm01_00129386 predicted 842
11 SASI_Mm01_00129385 predicted 424
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152654
DAND5 MISSION shRNA Bacterial Glycerol Stock
DAN domain family member 5, BMP antagonist
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-314s21c1
Sequence:CCGGCTGAACCCTCAGGAAGTGATCCTCGAGGATCACTTCCTGAGGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-346s21c1
Sequence:CCGGTAAGGCTGTGCCCTTCGTTCACTCGAGTGAACGAAGGGCACAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-468s21c1
Sequence:CCGGTAGTCCTGTGCAACAGCTGTACTCGAGTACAGCTGTTGCACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-610s21c1
Sequence:CCGGATGAACTGAGCATCGTGGATGCTCGAGCATCCACGATGCTCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152654.2-640s21c1
Sequence:CCGGAGACACGCACCTTGGAGAAATCTCGAGATTTCTCCAAGGTGCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-562s1c1
Sequence:CCGGGAAGATATCCACCATGCTGATCTCGAGATCAGCATGGTGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-404s1c1
Sequence:CCGGCGAAATCATCTGTGCTTTGGTCTCGAGACCAAAGCACAGATGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1281s1c1
Sequence:CCGGGAGACAGAGTTTCACCATATTCTCGAGAATATGGTGAAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1392s1c1
Sequence:CCGGGCTGAACTGTCTCTTATAGAACTCGAGTTCTATAAGAGACAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152654
DAND5 MISSION shRNA shRNA Plasmid DNA
DAN domain family member 5, BMP antagonist
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-314s21c1
Sequence:CCGGCTGAACCCTCAGGAAGTGATCCTCGAGGATCACTTCCTGAGGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-346s21c1
Sequence:CCGGTAAGGCTGTGCCCTTCGTTCACTCGAGTGAACGAAGGGCACAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-468s21c1
Sequence:CCGGTAGTCCTGTGCAACAGCTGTACTCGAGTACAGCTGTTGCACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-610s21c1
Sequence:CCGGATGAACTGAGCATCGTGGATGCTCGAGCATCCACGATGCTCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152654.2-640s21c1
Sequence:CCGGAGACACGCACCTTGGAGAAATCTCGAGATTTCTCCAAGGTGCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-562s1c1
Sequence:CCGGGAAGATATCCACCATGCTGATCTCGAGATCAGCATGGTGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-404s1c1
Sequence:CCGGCGAAATCATCTGTGCTTTGGTCTCGAGACCAAAGCACAGATGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1281s1c1
Sequence:CCGGGAGACAGAGTTTCACCATATTCTCGAGAATATGGTGAAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1392s1c1
Sequence:CCGGGCTGAACTGTCTCTTATAGAACTCGAGTTCTATAAGAGACAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152654
DAND5 MISSION shRNA Lentiviral Transduction Particles
DAN domain family member 5, BMP antagonist
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-314s21c1
Sequence:CCGGCTGAACCCTCAGGAAGTGATCCTCGAGGATCACTTCCTGAGGGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-346s21c1
Sequence:CCGGTAAGGCTGTGCCCTTCGTTCACTCGAGTGAACGAAGGGCACAGCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-468s21c1
Sequence:CCGGTAGTCCTGTGCAACAGCTGTACTCGAGTACAGCTGTTGCACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152654.2-610s21c1
Sequence:CCGGATGAACTGAGCATCGTGGATGCTCGAGCATCCACGATGCTCAGTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414029    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152654.2-640s21c1
Sequence:CCGGAGACACGCACCTTGGAGAAATCTCGAGATTTCTCCAAGGTGCGTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-562s1c1
Sequence:CCGGGAAGATATCCACCATGCTGATCTCGAGATCAGCATGGTGGATATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152654.1-404s1c1
Sequence:CCGGCGAAATCATCTGTGCTTTGGTCTCGAGACCAAAGCACAGATGATTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148148    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1281s1c1
Sequence:CCGGGAGACAGAGTTTCACCATATTCTCGAGAATATGGTGAAACTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147616    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152654.1-1392s1c1
Sequence:CCGGGCTGAACTGTCTCTTATAGAACTCGAGTTCTATAAGAGACAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201227
DAND5 MISSION shRNA Bacterial Glycerol Stock
DAN domain family member 5, BMP antagonist
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000097619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201227.2-942s1c1
Sequence:CCGGCGTATGTGATATGTGGAGGTTCTCGAGAACCTCCACATATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-424s1c1
Sequence:CCGGGACTTGTAAAGCTCTGTCCTTCTCGAGAAGGACAGAGCTTTACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-482s1c1
Sequence:CCGGCGGGTCCTTAATCATCTCTGTCTCGAGACAGAGATGATTAAGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-248s1c1
Sequence:CCGGGCTATCAATCAGAGCTGGACTCTCGAGAGTCCAGCTCTGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201227
DAND5 MISSION shRNA shRNA Plasmid DNA
DAN domain family member 5, BMP antagonist
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000097619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201227.2-942s1c1
Sequence:CCGGCGTATGTGATATGTGGAGGTTCTCGAGAACCTCCACATATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-424s1c1
Sequence:CCGGGACTTGTAAAGCTCTGTCCTTCTCGAGAAGGACAGAGCTTTACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-482s1c1
Sequence:CCGGCGGGTCCTTAATCATCTCTGTCTCGAGACAGAGATGATTAAGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-248s1c1
Sequence:CCGGGCTATCAATCAGAGCTGGACTCTCGAGAGTCCAGCTCTGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201227
DAND5 MISSION shRNA Lentiviral Transduction Particles
DAN domain family member 5, BMP antagonist
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000097619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201227.2-942s1c1
Sequence:CCGGCGTATGTGATATGTGGAGGTTCTCGAGAACCTCCACATATCACATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-424s1c1
Sequence:CCGGGACTTGTAAAGCTCTGTCCTTCTCGAGAAGGACAGAGCTTTACAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097623    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-482s1c1
Sequence:CCGGCGGGTCCTTAATCATCTCTGTCTCGAGACAGAGATGATTAAGGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201227.2-248s1c1
Sequence:CCGGGCTATCAATCAGAGCTGGACTCTCGAGAGTCCAGCTCTGATTGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks