EMAIL THIS PAGE TO A FRIEND

DAO

D-amino-acid oxidase

55 Gene Product Result for
Synonyms: DAAO DAMOX OXDA
UniProtKB ID: P14920, B2R7I5, Q16758, Q8N6R2
Gene ID:
Human(1610) Summary: This gene encodes the peroxisomal enzyme D-amino acid oxidase. The enzyme is a flavoprotein which uses flavin adenine dinucleotide (FAD) as its prosthetic group. Its substrates include a wide variety of D-amino acids, but it is inactive on the naturally occurring L-amino acids. Its biological function is not known; it may act as a detoxifying agent which removes D-amino acids that accumulate during aging. In mice, it degrades D-serine, a co-agonist of the NMDA receptor. This gene may play a role in the pathophysiology of schizophrenia. [provided by RefSeq, Jul 2008]
Mouse(13142) D-amino acid oxidase
Rat(114027) D-amino-acid oxidase
fruit fly(34891) down and out
cow(615334) D-amino-acid oxidase
domestic cat(101087429) D-amino-acid oxidase
dog(486317) D-amino-acid oxidase
chicken(416894) D-amino-acid oxidase
naked mole-rat(101715888) D-amino-acid oxidase
domestic guinea pig(100192327) D-amino acid oxidase
sheep(101115829) D-amino-acid oxidase
Domestic Rabbit(100008977) D-amino-acid oxidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010018 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010018 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010018 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001917 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU142781 MISSION® esiRNA esiRNA human DAO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001917 Rosetta Predictions human pricing
NM_053626 Rosetta Predictions rat pricing
NM_010018 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069202 predicted 879
2 SASI_Hs01_00069203 predicted 614
3 SASI_Hs01_00069204 predicted 541
4 SASI_Hs01_00069205 predicted 617
5 SASI_Hs01_00069206 predicted 514
6 SASI_Hs01_00069207 predicted 669
7 SASI_Hs01_00069208 predicted 1034
8 SASI_Hs01_00069209 predicted 346
9 SASI_Hs01_00069210 predicted 776
10 SASI_Hs02_00332801 predicted 1028
11 SASI_Hs01_00069211 predicted 231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053626 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064009 predicted 795
2 SASI_Rn01_00064010 predicted 282
3 SASI_Rn01_00064011 predicted 357
4 SASI_Rn01_00064012 predicted 321
5 SASI_Rn01_00064013 predicted 949
6 SASI_Rn01_00064014 predicted 961
7 SASI_Rn01_00064015 predicted 755
8 SASI_Rn01_00064016 predicted 196
9 SASI_Rn01_00064017 predicted 368
10 SASI_Rn01_00064018 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317635 predicted 756
2 SASI_Mm02_00317636 predicted 622
3 SASI_Mm01_00189594 predicted 913
4 SASI_Mm02_00317637 predicted 312
5 SASI_Mm02_00317638 predicted 975
6 SASI_Mm01_00189595 predicted 349
7 SASI_Mm02_00317639 predicted 193
8 SASI_Mm01_00189600 predicted 786
9 SASI_Mm02_00317640 predicted 1010
10 SASI_Mm02_00317641 predicted 764
11 SASI_Mm01_00189596 predicted 702
12 SASI_Mm01_00189597 predicted 692
13 SASI_Mm01_00189598 predicted 238
14 SASI_Mm01_00189599 predicted 522
15 SASI_Mm01_00189601 predicted 699
16 SASI_Mm01_00189602 predicted 749
17 SASI_Mm01_00189603 predicted 374
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010018
DAO MISSION shRNA Bacterial Glycerol Stock
D-amino-acid oxidase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-621s1c1
Sequence:CCGGCCCTTGGATTAAACACTTCATCTCGAGATGAAGTGTTTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-805s1c1
Sequence:CCGGACCCTGAAGAATGCAAGAATTCTCGAGAATTCTTGCATTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-51s1c1
Sequence:CCGGCCTCTGCATTCATGAGCGTTACTCGAGTAACGCTCATGAATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-774s1c1
Sequence:CCGGCATTTGGAAGAGCTGCTGTAACTCGAGTTACAGCAGCTCTTCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-436s1c1
Sequence:CCGGCCATGGCTAACTGAGAGGTTACTCGAGTAACCTCTCAGTTAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010018
DAO MISSION shRNA shRNA Plasmid DNA
D-amino-acid oxidase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-621s1c1
Sequence:CCGGCCCTTGGATTAAACACTTCATCTCGAGATGAAGTGTTTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-805s1c1
Sequence:CCGGACCCTGAAGAATGCAAGAATTCTCGAGAATTCTTGCATTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-51s1c1
Sequence:CCGGCCTCTGCATTCATGAGCGTTACTCGAGTAACGCTCATGAATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-774s1c1
Sequence:CCGGCATTTGGAAGAGCTGCTGTAACTCGAGTTACAGCAGCTCTTCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-436s1c1
Sequence:CCGGCCATGGCTAACTGAGAGGTTACTCGAGTAACCTCTCAGTTAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010018
DAO MISSION shRNA Lentiviral Transduction Particles
D-amino-acid oxidase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-621s1c1
Sequence:CCGGCCCTTGGATTAAACACTTCATCTCGAGATGAAGTGTTTAATCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-805s1c1
Sequence:CCGGACCCTGAAGAATGCAAGAATTCTCGAGAATTCTTGCATTCTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-51s1c1
Sequence:CCGGCCTCTGCATTCATGAGCGTTACTCGAGTAACGCTCATGAATGCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-774s1c1
Sequence:CCGGCATTTGGAAGAGCTGCTGTAACTCGAGTTACAGCAGCTCTTCCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010018.1-436s1c1
Sequence:CCGGCCATGGCTAACTGAGAGGTTACTCGAGTAACCTCTCAGTTAGCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001917
DAO MISSION shRNA Bacterial Glycerol Stock
D-amino-acid oxidase
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000046264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-1011s1c1
Sequence:CCGGCGGCTAGAAAGAGAACAGCTTCTCGAGAAGCTGTTCTCTTTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-227s1c1
Sequence:CCGGGCCACTGCACATAAAGGTCTACTCGAGTAGACCTTTATGTGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-612s1c1
Sequence:CCGGGTGAAGTTCTTCCAGCGGAAACTCGAGTTTCCGCTGGAAGAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000046266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-765s1c1
Sequence:CCGGCCTTGGATGAAGCACTTCATTCTCGAGAATGAAGTGCTTCATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-591s21c1
Sequence:CCGGGTGGCTGACTGAAAGGTTAACCTCGAGGTTAACCTTTCAGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-547s21c1
Sequence:CCGGTGGTTCCACACAAGCCTAATTCTCGAGAATTAGGCTTGTGTGGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-885s21c1
Sequence:CCGGGGGAAACTGGAGTGAACTAAACTCGAGTTTAGTTCACTCCAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001917.4-1256s21c1
Sequence:CCGGATCAATGTGCTCCTTCATAAGCTCGAGCTTATGAAGGAGCACATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001917
DAO MISSION shRNA shRNA Plasmid DNA
D-amino-acid oxidase
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000046264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-1011s1c1
Sequence:CCGGCGGCTAGAAAGAGAACAGCTTCTCGAGAAGCTGTTCTCTTTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-227s1c1
Sequence:CCGGGCCACTGCACATAAAGGTCTACTCGAGTAGACCTTTATGTGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-612s1c1
Sequence:CCGGGTGAAGTTCTTCCAGCGGAAACTCGAGTTTCCGCTGGAAGAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000046266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-765s1c1
Sequence:CCGGCCTTGGATGAAGCACTTCATTCTCGAGAATGAAGTGCTTCATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-591s21c1
Sequence:CCGGGTGGCTGACTGAAAGGTTAACCTCGAGGTTAACCTTTCAGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-547s21c1
Sequence:CCGGTGGTTCCACACAAGCCTAATTCTCGAGAATTAGGCTTGTGTGGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-885s21c1
Sequence:CCGGGGGAAACTGGAGTGAACTAAACTCGAGTTTAGTTCACTCCAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001917.4-1256s21c1
Sequence:CCGGATCAATGTGCTCCTTCATAAGCTCGAGCTTATGAAGGAGCACATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001917
DAO MISSION shRNA Lentiviral Transduction Particles
D-amino-acid oxidase
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000046264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-1011s1c1
Sequence:CCGGCGGCTAGAAAGAGAACAGCTTCTCGAGAAGCTGTTCTCTTTCTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-227s1c1
Sequence:CCGGGCCACTGCACATAAAGGTCTACTCGAGTAGACCTTTATGTGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-612s1c1
Sequence:CCGGGTGAAGTTCTTCCAGCGGAAACTCGAGTTTCCGCTGGAAGAACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000046266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001917.3-765s1c1
Sequence:CCGGCCTTGGATGAAGCACTTCATTCTCGAGAATGAAGTGCTTCATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-591s21c1
Sequence:CCGGGTGGCTGACTGAAAGGTTAACCTCGAGGTTAACCTTTCAGTCAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-547s21c1
Sequence:CCGGTGGTTCCACACAAGCCTAATTCTCGAGAATTAGGCTTGTGTGGAACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001917.4-885s21c1
Sequence:CCGGGGGAAACTGGAGTGAACTAAACTCGAGTTTAGTTCACTCCAGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414795    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001917.4-1256s21c1
Sequence:CCGGATCAATGTGCTCCTTCATAAGCTCGAGCTTATGAAGGAGCACATTGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks