EMAIL THIS PAGE TO A FRIEND

DAOA

D-amino acid oxidase activator

20 Gene Product Result for
Synonyms: LG72 SG72
Species: Human DAOA(267012)
UniProtKB ID: P59103, A6NKG7, Q0VAE6, Q5VX59, Q86Y17, Q8IWM4
Gene ID:
Human(267012) Summary: This gene encodes a protein that may function as an activator of D-amino acid oxidase, which degrades the gliotransmitter D-serine, a potent activator of N-methyl-D-aspartate (NMDA) type glutamate receptors. Studies also suggest that one encoded isoform may play a role in mitochondrial function and dendritic arborization. Polymorphisms in this gene have been implicated in susceptibility to schizophrenia and bipolar affective disorder. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Mar 2011]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172370 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172370 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172370 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172370 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058079 predicted 454
2 SASI_Hs01_00058080 predicted 388
3 SASI_Hs01_00058081 predicted 494
4 SASI_Hs01_00058083 predicted 463
5 SASI_Hs01_00058084 predicted 862
6 SASI_Hs01_00058086 predicted 471
7 SASI_Hs01_00058085 predicted 361
8 SASI_Hs01_00058087 predicted 864
9 SASI_Hs01_00058088 predicted 848
10 SASI_Hs02_00368025 predicted 416
11 SASI_Hs01_00058082 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172370
DAOA MISSION shRNA Bacterial Glycerol Stock
D-amino acid oxidase activator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-694s21c1
Sequence:CCGGGTCATGCAACCACAAGGAAATCTCGAGATTTCCTTGTGGTTGCATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-498s21c1
Sequence:CCGGGGCATTTACAGAGATCATTATCTCGAGATAATGATCTCTGTAAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-422s21c1
Sequence:CCGGGAAGGAAGAGAGACGGTAACACTCGAGTGTTACCGTCTCTCTTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-364s21c1
Sequence:CCGGGAGCATTCTTCTGAGCAAATCCTCGAGGATTTGCTCAGAAGAATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-471s1c1
Sequence:CCGGGCAACCACAAGGAAATAACTTCTCGAGAAGTTATTTCCTTGTGGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-368s1c1
Sequence:CCGGGCAAGAAACTATGAGTTCCTTCTCGAGAAGGAACTCATAGTTTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-90s1c1
Sequence:CCGGGATCCAGATATACATTGGGTACTCGAGTACCCAATGTATATCTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-247s1c1
Sequence:CCGGCGGCTATTTGGAAATGGCACACTCGAGTGTGCCATTTCCAAATAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-531s1c1
Sequence:CCGGGCCAATCCTTCTGATGACAATCTCGAGATTGTCATCAGAAGGATTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-561s1c1
Sequence:CCGGCCAACATCTTCACTGGACTCTCTCGAGAGAGTCCAGTGAAGATGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172370
DAOA MISSION shRNA shRNA Plasmid DNA
D-amino acid oxidase activator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-694s21c1
Sequence:CCGGGTCATGCAACCACAAGGAAATCTCGAGATTTCCTTGTGGTTGCATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-498s21c1
Sequence:CCGGGGCATTTACAGAGATCATTATCTCGAGATAATGATCTCTGTAAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-422s21c1
Sequence:CCGGGAAGGAAGAGAGACGGTAACACTCGAGTGTTACCGTCTCTCTTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-364s21c1
Sequence:CCGGGAGCATTCTTCTGAGCAAATCCTCGAGGATTTGCTCAGAAGAATGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-471s1c1
Sequence:CCGGGCAACCACAAGGAAATAACTTCTCGAGAAGTTATTTCCTTGTGGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-368s1c1
Sequence:CCGGGCAAGAAACTATGAGTTCCTTCTCGAGAAGGAACTCATAGTTTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-90s1c1
Sequence:CCGGGATCCAGATATACATTGGGTACTCGAGTACCCAATGTATATCTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-247s1c1
Sequence:CCGGCGGCTATTTGGAAATGGCACACTCGAGTGTGCCATTTCCAAATAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-531s1c1
Sequence:CCGGGCCAATCCTTCTGATGACAATCTCGAGATTGTCATCAGAAGGATTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-561s1c1
Sequence:CCGGCCAACATCTTCACTGGACTCTCTCGAGAGAGTCCAGTGAAGATGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172370
DAOA MISSION shRNA Lentiviral Transduction Particles
D-amino acid oxidase activator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-694s21c1
Sequence:CCGGGTCATGCAACCACAAGGAAATCTCGAGATTTCCTTGTGGTTGCATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431525    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-498s21c1
Sequence:CCGGGGCATTTACAGAGATCATTATCTCGAGATAATGATCTCTGTAAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-422s21c1
Sequence:CCGGGAAGGAAGAGAGACGGTAACACTCGAGTGTTACCGTCTCTCTTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172370.3-364s21c1
Sequence:CCGGGAGCATTCTTCTGAGCAAATCCTCGAGGATTTGCTCAGAAGAATGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147492    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-471s1c1
Sequence:CCGGGCAACCACAAGGAAATAACTTCTCGAGAAGTTATTTCCTTGTGGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-368s1c1
Sequence:CCGGGCAAGAAACTATGAGTTCCTTCTCGAGAAGGAACTCATAGTTTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-90s1c1
Sequence:CCGGGATCCAGATATACATTGGGTACTCGAGTACCCAATGTATATCTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180118    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-247s1c1
Sequence:CCGGCGGCTATTTGGAAATGGCACACTCGAGTGTGCCATTTCCAAATAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179508    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-531s1c1
Sequence:CCGGGCCAATCCTTCTGATGACAATCTCGAGATTGTCATCAGAAGGATTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172370.2-561s1c1
Sequence:CCGGCCAACATCTTCACTGGACTCTCTCGAGAGAGTCCAGTGAAGATGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)