EMAIL THIS PAGE TO A FRIEND

DAP3

death associated protein 3

81 Gene Product Result for
Synonyms: DAP-3 MRP-S29 MRPS29 bMRP-10
Gene ID:
Human(7818) Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that also participates in apoptotic pathways which are initiated by tumor necrosis factor-alpha, Fas ligand, and gamma interferon. This protein potentially binds ATP/GTP and might be a functional partner of the mitoribosomal protein S27. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 1q and 2q. [provided by RefSeq, Dec 2010]
Mouse(65111) death associated protein 3
Rat(295238) death associated protein 3
Zebrafish(559007) death associated protein 3
chicken(425065) death associated protein 3
dog(480127) death associated protein 3
cow(504320) death associated protein 3
domestic cat(101087963) death associated protein 3
naked mole-rat(101724202) death associated protein 3
domestic guinea pig(100717861) death associated protein 3
sheep(101120032) death associated protein 3
Domestic Rabbit(100353283) death associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022994 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_022994 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_022994 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004632 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004632 Rosetta Predictions human pricing
NM_033657 Rosetta Predictions human pricing
NM_001011950 Rosetta Predictions rat pricing
XM_574977 Rosetta Predictions rat pricing
NM_022994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086210 predicted 510
2 SASI_Hs01_00086211 predicted 1135
3 SASI_Hs01_00086212 predicted 1132
4 SASI_Hs01_00086216 predicted 500
5 SASI_Hs01_00086217 predicted 445
6 SASI_Hs01_00086218 predicted 1113
7 SASI_Hs02_00338031 predicted 417
8 SASI_Hs02_00338032 predicted 847
9 SASI_Hs02_00338033 predicted 737
10 SASI_Hs02_00338034 predicted 1162
11 SASI_Hs01_00086213 predicted 625
12 SASI_Hs01_00086214 predicted 843
13 SASI_Hs01_00086215 predicted 835
14 SASI_Hs01_00086219 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131595 predicted 584
2 SASI_Hs01_00131596 predicted 1202
3 SASI_Hs01_00131597 predicted 1201
4 SASI_Hs01_00131601 predicted 573
5 SASI_Hs01_00131602 predicted 517
6 SASI_Hs01_00131603 predicted 1183
7 SASI_Hs02_00361467 predicted 483
8 SASI_Hs02_00361468 predicted 907
9 SASI_Hs02_00361469 predicted 808
10 SASI_Hs02_00361470 predicted 1232
11 SASI_Hs01_00131598 predicted 686
12 SASI_Hs01_00131599 predicted 908
13 SASI_Hs01_00131600 predicted 908
14 SASI_Hs01_00131604 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076782 predicted 916
2 SASI_Rn01_00076784 predicted 355
3 SASI_Rn02_00199964 predicted 663
4 SASI_Rn01_00076785 predicted 1338
5 SASI_Rn01_00076786 predicted 1268
6 SASI_Rn01_00076787 predicted 1207
7 SASI_Rn01_00076788 predicted 697
8 SASI_Rn01_00076789 predicted 562
9 SASI_Rn02_00199965 predicted 1406
10 SASI_Rn01_00076791 predicted 1362
11 SASI_Rn01_00076783 predicted 889
12 SASI_Rn01_00076790 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148263 predicted 921
2 SASI_Rn01_00148264 predicted 895
3 SASI_Rn01_00148265 predicted 364
4 SASI_Rn01_00148266 predicted 1338
5 SASI_Rn01_00148267 predicted 1281
6 SASI_Rn01_00148268 predicted 1212
7 SASI_Rn01_00148269 predicted 703
8 SASI_Rn01_00148270 predicted 570
9 SASI_Rn01_00148271 predicted 730
10 SASI_Rn01_00148272 predicted 1360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081065 predicted 1018
2 SASI_Mm01_00081066 predicted 656
3 SASI_Mm01_00081067 predicted 1310
4 SASI_Mm01_00081068 predicted 1670
5 SASI_Mm01_00081069 predicted 921
6 SASI_Mm01_00081070 predicted 915
7 SASI_Mm01_00081072 predicted 791
8 SASI_Mm01_00081073 predicted 464
9 SASI_Mm02_00326717 predicted 1434
10 SASI_Mm02_00326718 predicted 1510
11 SASI_Mm01_00081071 predicted 1056
12 SASI_Mm01_00081074 predicted 1494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022994
VALIDATED
DAP3 MISSION shRNA Bacterial Glycerol Stock
death associated protein 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-873s21c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1019s21c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1067s21c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-622s21c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022994.2-1700s21c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1067s1c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-873s1c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-622s1c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1700s1c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1019s1c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022994
VALIDATED
DAP3 MISSION shRNA shRNA Plasmid DNA
death associated protein 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-873s21c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1019s21c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1067s21c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-622s21c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022994.2-1700s21c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1067s1c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-873s1c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-622s1c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1700s1c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1019s1c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022994
VALIDATED
DAP3 MISSION shRNA Lentiviral Transduction Particles
death associated protein 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-873s21c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1019s21c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-1067s21c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022994.2-622s21c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022994.2-1700s21c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1067s1c1
Sequence:CCGGCCTCTGGGAGAAGTTGTTGAACTCGAGTTCAACAACTTCTCCCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-873s1c1
Sequence:CCGGCAGATGCTCATCTTTGGGTAACTCGAGTTACCCAAAGATGAGCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-622s1c1
Sequence:CCGGCCAGGATCTGAAGACAGTGTTCTCGAGAACACTGTCTTCAGATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1700s1c1
Sequence:CCGGCCTGCACTGATGGATATGAAACTCGAGTTTCATATCCATCAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_022994.2-1019s1c1
Sequence:CCGGCAAGAGAAGTATGTTTGGAATCTCGAGATTCCAAACATACTTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004632
VALIDATED
DAP3 MISSION shRNA Bacterial Glycerol Stock
death associated protein 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004632.2-1127s21c1
Sequence:GTACCGGATCCTGGTTTCCAACTATAACCTCGAGGTTATAGTTGGAAACCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-626s21c1
Sequence:CCGGCAGCGCTTTGATCAACCTTTACTCGAGTAAAGGTTGATCAAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-452s21c1
Sequence:CCGGGCTTATCCAGCTATACGATATCTCGAGATATCGTATAGCTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-193s21c1
Sequence:CCGGCATTGCTGCTCACCTAGATAACTCGAGTTATCTAGGTGAGCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-1429s21c1
Sequence:CCGGTTGGCTCTGGACCTGCATTAACTCGAGTTAATGCAGGTCCAGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1458s1c1
Sequence:CCGGTCACTGTGAATGCGTGACAATCTCGAGATTGTCACGCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1126s1c1
Sequence:CCGGCATCCTGGTTTCCAACTATAACTCGAGTTATAGTTGGAAACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-389s1c1
Sequence:CCGGGCTTGCCTGATGGTAAGGAAACTCGAGTTTCCTTACCATCAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004632.2-950s1c1
Sequence:CCGGCCCGAGGAATTAGCACTTGTTCTCGAGAACAAGTGCTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004632
VALIDATED
DAP3 MISSION shRNA shRNA Plasmid DNA
death associated protein 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004632.2-1127s21c1
Sequence:GTACCGGATCCTGGTTTCCAACTATAACCTCGAGGTTATAGTTGGAAACCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-626s21c1
Sequence:CCGGCAGCGCTTTGATCAACCTTTACTCGAGTAAAGGTTGATCAAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-452s21c1
Sequence:CCGGGCTTATCCAGCTATACGATATCTCGAGATATCGTATAGCTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-193s21c1
Sequence:CCGGCATTGCTGCTCACCTAGATAACTCGAGTTATCTAGGTGAGCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-1429s21c1
Sequence:CCGGTTGGCTCTGGACCTGCATTAACTCGAGTTAATGCAGGTCCAGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1458s1c1
Sequence:CCGGTCACTGTGAATGCGTGACAATCTCGAGATTGTCACGCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1126s1c1
Sequence:CCGGCATCCTGGTTTCCAACTATAACTCGAGTTATAGTTGGAAACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-389s1c1
Sequence:CCGGGCTTGCCTGATGGTAAGGAAACTCGAGTTTCCTTACCATCAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004632.2-950s1c1
Sequence:CCGGCCCGAGGAATTAGCACTTGTTCTCGAGAACAAGTGCTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004632
VALIDATED
DAP3 MISSION shRNA Lentiviral Transduction Particles
death associated protein 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004632.2-1127s21c1
Sequence:GTACCGGATCCTGGTTTCCAACTATAACCTCGAGGTTATAGTTGGAAACCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-626s21c1
Sequence:CCGGCAGCGCTTTGATCAACCTTTACTCGAGTAAAGGTTGATCAAAGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-452s21c1
Sequence:CCGGGCTTATCCAGCTATACGATATCTCGAGATATCGTATAGCTGGATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-193s21c1
Sequence:CCGGCATTGCTGCTCACCTAGATAACTCGAGTTATCTAGGTGAGCAGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257104    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004632.2-1429s21c1
Sequence:CCGGTTGGCTCTGGACCTGCATTAACTCGAGTTAATGCAGGTCCAGAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117432    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1458s1c1
Sequence:CCGGTCACTGTGAATGCGTGACAATCTCGAGATTGTCACGCATTCACAGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-1126s1c1
Sequence:CCGGCATCCTGGTTTCCAACTATAACTCGAGTTATAGTTGGAAACCAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_004632.2-389s1c1
Sequence:CCGGGCTTGCCTGATGGTAAGGAAACTCGAGTTTCCTTACCATCAGGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004632.2-950s1c1
Sequence:CCGGCCCGAGGAATTAGCACTTGTTCTCGAGAACAAGTGCTAATTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks