EMAIL THIS PAGE TO A FRIEND

DAP

death-associated protein

55 Gene Product Result for
UniProtKB ID: P51397, Q6FGC3, Q9BUC9
Gene ID:
Human(1611) Summary: This gene encodes a basic, proline-rich, 15-kD protein. The protein acts as a positive mediator of programmed cell death that is induced by interferon-gamma. [provided by RefSeq, Jul 2008]
Mouse(223453) death-associated protein
Rat(64322) death-associated protein
Zebrafish(58093) death associated protein
domestic cat(101090169) death-associated protein
cow(616066) death-associated protein
dog(607300) death-associated protein
chicken(420923) death-associated protein
sheep(101105188) death-associated protein
domestic guinea pig(100733953) death-associated protein
naked mole-rat(101725513) death-associated protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004394 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004394 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004394 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004394 Rosetta Predictions human pricing
NM_022526 Rosetta Predictions rat pricing
NM_146057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004394 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124072 predicted 942
2 SASI_Hs01_00124073 predicted 703
3 SASI_Hs01_00124074 predicted 814
4 SASI_Hs02_00337508 predicted 351
5 SASI_Hs02_00337509 predicted 352
6 SASI_Hs01_00124075 predicted 801
7 SASI_Hs02_00337510 predicted 815
8 SASI_Hs01_00124076 predicted 709
9 SASI_Hs02_00337511 predicted 547
10 SASI_Hs01_00124079 predicted 982
11 SASI_Hs01_00124077 predicted 602
12 SASI_Hs01_00124078 predicted 814
13 SASI_Hs01_00124080 predicted 530
14 SASI_Hs01_00124081 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065053 predicted 771
2 SASI_Rn01_00065054 predicted 854
3 SASI_Rn01_00065055 predicted 803
4 SASI_Rn01_00065056 predicted 976
5 SASI_Rn01_00065061 predicted 803
6 SASI_Rn01_00065057 predicted 759
7 SASI_Rn01_00065058 predicted 865
8 SASI_Rn01_00065059 predicted 823
9 SASI_Rn01_00065062 predicted 600
10 SASI_Rn02_00263275 predicted 351
11 SASI_Rn01_00065060 predicted 797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057611 predicted 734
2 SASI_Mm01_00057612 predicted 769
3 SASI_Mm01_00057614 predicted 707
4 SASI_Mm01_00057615 predicted 716
5 SASI_Mm01_00057616 predicted 693
6 SASI_Mm01_00057617 predicted 754
7 SASI_Mm01_00057619 predicted 761
8 SASI_Mm01_00057620 predicted 749
9 SASI_Mm02_00341670 predicted 511
10 SASI_Mm02_00341671 predicted 530
11 SASI_Mm01_00057613 predicted 220
12 SASI_Mm01_00057618 predicted 775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146057
DAP MISSION shRNA Bacterial Glycerol Stock
death-associated protein
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146057.1-530s1c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-261s1c1
Sequence:CCGGCCCACCTAAACCAACAGTGTTCTCGAGAACACTGTTGGTTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-223s1c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-277s1c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-368s1c1
Sequence:CCGGACAAACACGTTTCTCCAAGAACTCGAGTTCTTGGAGAAACGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-419s21c1
Sequence:CCGGCAAGAACGCAGCATATCCAACCTCGAGGTTGGATATGCTGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-237s21c1
Sequence:CCGGACATACCGGAGATGGGAAGGACTCGAGTCCTTCCCATCTCCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146057.2-526s21c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-219s21c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-273s21c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-391s21c1
Sequence:CCGGATATCCAACAGCCTCGCAAGTCTCGAGACTTGCGAGGCTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-340s21c1
Sequence:CCGGGGTGACAAAGACTTCCCTCCACTCGAGTGGAGGGAAGTCTTTGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-286s21c1
Sequence:CCGGGAAAGCACCAGCCCACCTAAACTCGAGTTTAGGTGGGCTGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146057
DAP MISSION shRNA shRNA Plasmid DNA
death-associated protein
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146057.1-530s1c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-261s1c1
Sequence:CCGGCCCACCTAAACCAACAGTGTTCTCGAGAACACTGTTGGTTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-223s1c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-277s1c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-368s1c1
Sequence:CCGGACAAACACGTTTCTCCAAGAACTCGAGTTCTTGGAGAAACGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-419s21c1
Sequence:CCGGCAAGAACGCAGCATATCCAACCTCGAGGTTGGATATGCTGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-237s21c1
Sequence:CCGGACATACCGGAGATGGGAAGGACTCGAGTCCTTCCCATCTCCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146057.2-526s21c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-219s21c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-273s21c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-391s21c1
Sequence:CCGGATATCCAACAGCCTCGCAAGTCTCGAGACTTGCGAGGCTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-340s21c1
Sequence:CCGGGGTGACAAAGACTTCCCTCCACTCGAGTGGAGGGAAGTCTTTGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-286s21c1
Sequence:CCGGGAAAGCACCAGCCCACCTAAACTCGAGTTTAGGTGGGCTGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146057
DAP MISSION shRNA Lentiviral Transduction Particles
death-associated protein
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146057.1-530s1c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-261s1c1
Sequence:CCGGCCCACCTAAACCAACAGTGTTCTCGAGAACACTGTTGGTTTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-223s1c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-277s1c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146057.1-368s1c1
Sequence:CCGGACAAACACGTTTCTCCAAGAACTCGAGTTCTTGGAGAAACGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-419s21c1
Sequence:CCGGCAAGAACGCAGCATATCCAACCTCGAGGTTGGATATGCTGCGTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-237s21c1
Sequence:CCGGACATACCGGAGATGGGAAGGACTCGAGTCCTTCCCATCTCCGGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146057.2-526s21c1
Sequence:CCGGCCACAGAGTTTACTACATTTACTCGAGTAAATGTAGTAAACTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-219s21c1
Sequence:CCGGGAGAGAGACAAGGATGACCAACTCGAGTTGGTCATCCTTGTCTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-273s21c1
Sequence:CCGGGTGTTCATCTCTGGCGTTATTCTCGAGAATAACGCCAGAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.2-391s21c1
Sequence:CCGGATATCCAACAGCCTCGCAAGTCTCGAGACTTGCGAGGCTGTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-340s21c1
Sequence:CCGGGGTGACAAAGACTTCCCTCCACTCGAGTGGAGGGAAGTCTTTGTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146057.3-286s21c1
Sequence:CCGGGAAAGCACCAGCCCACCTAAACTCGAGTTTAGGTGGGCTGGTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004394
VALIDATED
DAP MISSION shRNA Bacterial Glycerol Stock
death-associated protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-1332s1c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-315s1c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-444s1c1
Sequence:CCGGGCACATCCAGCAGCCACGCAACTCGAGTTGCGTGGCTGCTGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-232s1c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004394.1-210s1c1
Sequence:CCGGCGCCGTGAAAGCTGGTGGAATCTCGAGATTCCACCAGCTTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-455s21c1
Sequence:CCGGATGCCTCCATGGACAAGCATCCTCGAGGATGCTTGTCCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-332s21c1
Sequence:CCGGAGGATGACCAGGAATGGGAAACTCGAGTTTCCCATTCCTGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-363s21c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-280s21c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-1380s21c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004394
VALIDATED
DAP MISSION shRNA shRNA Plasmid DNA
death-associated protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-1332s1c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-315s1c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-444s1c1
Sequence:CCGGGCACATCCAGCAGCCACGCAACTCGAGTTGCGTGGCTGCTGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-232s1c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004394.1-210s1c1
Sequence:CCGGCGCCGTGAAAGCTGGTGGAATCTCGAGATTCCACCAGCTTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-455s21c1
Sequence:CCGGATGCCTCCATGGACAAGCATCCTCGAGGATGCTTGTCCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-332s21c1
Sequence:CCGGAGGATGACCAGGAATGGGAAACTCGAGTTTCCCATTCCTGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-363s21c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-280s21c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-1380s21c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004394
VALIDATED
DAP MISSION shRNA Lentiviral Transduction Particles
death-associated protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107215    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-1332s1c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-315s1c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-444s1c1
Sequence:CCGGGCACATCCAGCAGCCACGCAACTCGAGTTGCGTGGCTGCTGGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004394.1-232s1c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004394.1-210s1c1
Sequence:CCGGCGCCGTGAAAGCTGGTGGAATCTCGAGATTCCACCAGCTTTCACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-455s21c1
Sequence:CCGGATGCCTCCATGGACAAGCATCCTCGAGGATGCTTGTCCATGGAGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-332s21c1
Sequence:CCGGAGGATGACCAGGAATGGGAAACTCGAGTTTCCCATTCCTGGTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-363s21c1
Sequence:CCGGACCTAAACCCACTGTGTTCATCTCGAGATGAACACAGTGGGTTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-280s21c1
Sequence:CCGGCGAATTGTGCAGAAACACCCACTCGAGTGGGTGTTTCTGCACAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_004394.2-1380s21c1
Sequence:CCGGCCAGATAAGAAACCTGCCCTTCTCGAGAAGGGCAGGTTTCTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks