EMAIL THIS PAGE TO A FRIEND

DAPK1

death-associated protein kinase 1

208 Gene Product Result for
Synonyms: DAPK
Gene ID:
Human(1612) Summary: Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. [provided by RefSeq, Jul 2008]
Mouse(69635) death associated protein kinase 1
Rat(306722) death associated protein kinase 1
Zebrafish(558314) death-associated protein kinase 1
cow(540873) death-associated protein kinase 1
Horse(100061567) death-associated protein kinase 1
domestic cat(101084322) death-associated protein kinase 1
dog(484142) death-associated protein kinase 1
chicken(431670) death-associated protein kinase 1
sheep(101113985) death-associated protein kinase 1
Domestic Rabbit(100343775) death-associated protein kinase 1
domestic guinea pig(100720363) death-associated protein kinase 1
naked mole-rat(101723905) death-associated protein kinase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004938 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004938 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004938 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015411 MISSION® esiRNA esiRNA targeting human DAPK1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004938 Rosetta Predictions human pricing
NM_001107335 Rosetta Predictions rat pricing
XM_225138 Rosetta Predictions rat pricing
NM_029653 Rosetta Predictions mouse pricing
NM_134062 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238225 predicted 1579
2 SASI_Hs01_00238226 predicted 1473
3 SASI_Hs01_00238228 predicted 3189
4 SASI_Hs01_00238229 predicted 1545
5 SASI_Hs01_00238230 predicted 1998
6 SASI_Hs01_00238231 predicted 773
7 SASI_Hs01_00238232 predicted 1976
8 SASI_Hs01_00238233 predicted 2869
9 SASI_Hs02_00338609 predicted 1961
10 SASI_Hs02_00338610 predicted 677
11 SASI_Hs01_00238227 predicted 2438
12 SASI_Hs01_00238234 predicted 1755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107335 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227825 predicted 2103
2 SASI_Rn02_00227826 predicted 2310
3 SASI_Rn02_00227827 predicted 1736
4 SASI_Rn02_00227828 predicted 4281
5 SASI_Rn02_00227829 predicted 3809
6 SASI_Rn02_00227830 predicted 1712
7 SASI_Rn02_00227831 predicted 1906
8 SASI_Rn02_00227832 predicted 3307
9 SASI_Rn02_00227833 predicted 1620
10 SASI_Rn02_00227834 predicted 2458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131820 predicted 2122
2 SASI_Rn01_00131821 predicted 2339
3 SASI_Rn01_00131822 predicted 520
4 SASI_Rn01_00131823 predicted 1774
5 SASI_Rn01_00131824 predicted 737
6 SASI_Rn01_00131825 predicted 4311
7 SASI_Rn01_00131826 predicted 3841
8 SASI_Rn01_00131827 predicted 1111
9 SASI_Rn01_00131828 predicted 813
10 SASI_Rn01_00131829 predicted 1737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154214 predicted 2326
2 SASI_Mm02_00335662 predicted 2347
3 SASI_Mm02_00335663 predicted 2542
4 SASI_Mm01_00154216 predicted 3081
5 SASI_Mm02_00335664 predicted 4060
6 SASI_Mm01_00154217 predicted 4157
7 SASI_Mm01_00154219 predicted 1105
8 SASI_Mm01_00154220 predicted 1734
9 SASI_Mm01_00154222 predicted 3084
10 SASI_Mm02_00335665 predicted 2666
11 SASI_Mm01_00154215 predicted 1488
12 SASI_Mm01_00154218 predicted 4484
13 SASI_Mm01_00154221 predicted 4351
14 SASI_Mm01_00154223 predicted 4427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134062 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339226 predicted 2209
2 SASI_Mm02_00339227 predicted 2225
3 SASI_Mm02_00339228 predicted 2429
4 SASI_Mm02_00339229 predicted 2959
5 SASI_Mm02_00339230 predicted 3937
6 SASI_Mm02_00339231 predicted 4047
7 SASI_Mm02_00339232 predicted 991
8 SASI_Mm02_00339233 predicted 1623
9 SASI_Mm02_00339234 predicted 2971
10 SASI_Mm02_00339235 predicted 2554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004938
VALIDATED
DAPK1 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004938.2-3193s1c1
Sequence:CCGGGACATGAAGGTACTTCGAAATCTCGAGATTTCGAAGTACCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004938.2-4965s1c1
Sequence:CCGGCCTTGCTTCTTACTGATAATTCTCGAGAATTATCAGTAAGAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-5734s1c1
Sequence:CCGGCTGTCCTGAGAAGCATGTAATCTCGAGATTACATGCTTCTCAGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-2727s1c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-1605s1c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-4590s1c1
Sequence:CCGGCGGCACCTCTTACAATTCCATCTCGAGATGGAATTGTAAGAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1644s21c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2071s21c1
Sequence:CCGGCAAGGGTGTTTCGTCGATTATCTCGAGATAATCGACGAAACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2763s21c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-4963s21c1
Sequence:CCGGTACCTTGCTTCTTACTGATAACTCGAGTTATCAGTAAGAAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1063s21c1
Sequence:CCGGTCCGCTGTCAACTACGAATTTCTCGAGAAATTCGTAGTTGACAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004938
VALIDATED
DAPK1 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004938.2-3193s1c1
Sequence:CCGGGACATGAAGGTACTTCGAAATCTCGAGATTTCGAAGTACCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004938.2-4965s1c1
Sequence:CCGGCCTTGCTTCTTACTGATAATTCTCGAGAATTATCAGTAAGAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-5734s1c1
Sequence:CCGGCTGTCCTGAGAAGCATGTAATCTCGAGATTACATGCTTCTCAGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-2727s1c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-1605s1c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-4590s1c1
Sequence:CCGGCGGCACCTCTTACAATTCCATCTCGAGATGGAATTGTAAGAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1644s21c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2071s21c1
Sequence:CCGGCAAGGGTGTTTCGTCGATTATCTCGAGATAATCGACGAAACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2763s21c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-4963s21c1
Sequence:CCGGTACCTTGCTTCTTACTGATAACTCGAGTTATCAGTAAGAAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1063s21c1
Sequence:CCGGTCCGCTGTCAACTACGAATTTCTCGAGAAATTCGTAGTTGACAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004938
VALIDATED
DAPK1 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004938.2-3193s1c1
Sequence:CCGGGACATGAAGGTACTTCGAAATCTCGAGATTTCGAAGTACCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194694    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_004938.2-4965s1c1
Sequence:CCGGCCTTGCTTCTTACTGATAATTCTCGAGAATTATCAGTAAGAAGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000982    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-5734s1c1
Sequence:CCGGCTGTCCTGAGAAGCATGTAATCTCGAGATTACATGCTTCTCAGGACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-2727s1c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-1605s1c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004938.x-4590s1c1
Sequence:CCGGCGGCACCTCTTACAATTCCATCTCGAGATGGAATTGTAAGAGGTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1644s21c1
Sequence:CCGGCCACGTCGATACCTTGAAATTCTCGAGAATTTCAAGGTATCGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2071s21c1
Sequence:CCGGCAAGGGTGTTTCGTCGATTATCTCGAGATAATCGACGAAACACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-2763s21c1
Sequence:CCGGCGACATCCAGAACGCTTATTTCTCGAGAAATAAGCGTTCTGGATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273223    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-4963s21c1
Sequence:CCGGTACCTTGCTTCTTACTGATAACTCGAGTTATCAGTAAGAAGCAAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004938.2-1063s21c1
Sequence:CCGGTCCGCTGTCAACTACGAATTTCTCGAGAAATTCGTAGTTGACAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029653
VALIDATED
DAPK1 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-575s1c1
Sequence:CCGGCGGATCAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2560s1c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2876s1c1
Sequence:CCGGCATGTCTCAAACAAGCTGTTTCTCGAGAAACAGCTTGTTTGAGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1520s1c1
Sequence:CCGGCCTGATTTCCAGGACAAGGAACTCGAGTTCCTTGTCCTGGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1038s1c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-963s21c1
Sequence:CCGGCCGCTGTCAACTACGACTTTGCTCGAGCAAAGTCGTAGTTGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1771s21c1
Sequence:CCGGAGTTGGCTGCAACGTGAATATCTCGAGATATTCACGTTGCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029653.2-4973s21c1
Sequence:CCGGAGACACACATTTATCCATAATCTCGAGATTATGGATAAATGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-2725s21c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1203s21c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029653
VALIDATED
DAPK1 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-575s1c1
Sequence:CCGGCGGATCAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2560s1c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2876s1c1
Sequence:CCGGCATGTCTCAAACAAGCTGTTTCTCGAGAAACAGCTTGTTTGAGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1520s1c1
Sequence:CCGGCCTGATTTCCAGGACAAGGAACTCGAGTTCCTTGTCCTGGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1038s1c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-963s21c1
Sequence:CCGGCCGCTGTCAACTACGACTTTGCTCGAGCAAAGTCGTAGTTGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1771s21c1
Sequence:CCGGAGTTGGCTGCAACGTGAATATCTCGAGATATTCACGTTGCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029653.2-4973s21c1
Sequence:CCGGAGACACACATTTATCCATAATCTCGAGATTATGGATAAATGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-2725s21c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1203s21c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029653
VALIDATED
DAPK1 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-575s1c1
Sequence:CCGGCGGATCAAGATCATAGACTTTCTCGAGAAAGTCTATGATCTTGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2560s1c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-2876s1c1
Sequence:CCGGCATGTCTCAAACAAGCTGTTTCTCGAGAAACAGCTTGTTTGAGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1520s1c1
Sequence:CCGGCCTGATTTCCAGGACAAGGAACTCGAGTTCCTTGTCCTGGAAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029653.1-1038s1c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-963s21c1
Sequence:CCGGCCGCTGTCAACTACGACTTTGCTCGAGCAAAGTCGTAGTTGACAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1771s21c1
Sequence:CCGGAGTTGGCTGCAACGTGAATATCTCGAGATATTCACGTTGCAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029653.2-4973s21c1
Sequence:CCGGAGACACACATTTATCCATAATCTCGAGATTATGGATAAATGTGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-2725s21c1
Sequence:CCGGCCCTGTGTACTTCTGTTGCTACTCGAGTAGCAACAGAAGTACACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029653.2-1203s21c1
Sequence:CCGGGCTTGATATCACTGTGCCAAACTCGAGTTTGGCACAGTGATATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks