EMAIL THIS PAGE TO A FRIEND

DAPK2

death-associated protein kinase 2

112 Gene Product Result for
Synonyms: DRP-1 DRP1
UniProtKB ID: Q9UIK4, E9JGM7, O75892, Q24JS1
Gene ID:
Human(23604) Summary: This gene encodes a protein that belongs to the serine/threonine protein kinase family. This protein contains a N-terminal protein kinase domain followed by a conserved calmodulin-binding domain with significant similarity to that of death-associated protein kinase 1 (DAPK1), a positive regulator of programmed cell death. Overexpression of this gene was shown to induce cell apoptosis. It uses multiple polyadenylation sites. [provided by RefSeq, Jul 2008]
Mouse(13143) death-associated protein kinase 2
Rat(300799) death-associated protein kinase 2
Zebrafish(571352) death-associated protein kinase 2
cow(529131) death-associated protein kinase 2
chicken(100857587) death-associated protein kinase 2
domestic cat(101089774) death-associated protein kinase 2
cow(100847631) death-associated protein kinase 2
Horse(100066921) death-associated protein kinase 2
dog(610682) death-associated protein kinase 2
naked mole-rat(101708121) death-associated protein kinase 2
domestic guinea pig(100730150) death-associated protein kinase 2
sheep(101123304) death-associated protein kinase 2
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
D3191 Anti-DAP Kinase 2 antibody produced in rabbit ~0.5 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, rat, human
microarray, western blot pricing
D3069 Anti-DAPK2 (11-25) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
D3194 Anti-DAPK2 (286-300) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2500294 Anti-DAPK2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB3500239 Anti-DAPK2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
HPA071581 Anti-DAPK2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1304740 ANTI-MOUSE DAPK2 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB4504163 Anti-phospho-DAPK2 (pSer318) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry pricing
WH0023604M1 Monoclonal Anti-DAPK2 antibody produced in mouse clone 3D4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404982 Monoclonal Anti-DAPK2, (C-terminal) antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014326 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014326 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014326 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036031 MISSION® esiRNA esiRNA human DAPK2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014326 Rosetta Predictions human pricing
NM_001013109 Rosetta Predictions rat pricing
NM_010019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206404 predicted 1347
2 SASI_Hs01_00206405 predicted 599
3 SASI_Hs02_00345443 predicted 807
4 SASI_Hs01_00206406 predicted 534
5 SASI_Hs01_00206407 predicted 520
6 SASI_Hs01_00206408 predicted 758
7 SASI_Hs01_00206410 predicted 532
8 SASI_Hs01_00206411 predicted 1130
9 SASI_Hs01_00206412 predicted 563
10 SASI_Hs01_00206413 predicted 614
11 SASI_Hs01_00206409 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098219 predicted 609
2 SASI_Rn01_00098220 predicted 401
3 SASI_Rn01_00098222 predicted 213
4 SASI_Rn01_00098223 predicted 603
5 SASI_Rn01_00098225 predicted 522
6 SASI_Rn01_00098227 predicted 540
7 SASI_Rn01_00098228 predicted 352
8 SASI_Rn02_00200796 predicted 667
9 SASI_Rn02_00200797 predicted 589
10 SASI_Rn02_00200798 predicted 688
11 SASI_Rn01_00098221 predicted 329
12 SASI_Rn01_00098224 predicted 534
13 SASI_Rn01_00098226 predicted 648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162357 predicted 1101
2 SASI_Mm01_00162358 predicted 630
3 SASI_Mm01_00162359 predicted 490
4 SASI_Mm01_00162360 predicted 688
5 SASI_Mm01_00162361 predicted 1096
6 SASI_Mm01_00162362 predicted 700
7 SASI_Mm01_00162363 predicted 615
8 SASI_Mm01_00162364 predicted 811
9 SASI_Mm01_00162365 predicted 821
10 SASI_Mm01_00162366 predicted 847
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010019
DAPK2 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-465s21c1
Sequence:CCGGTGGCCCAGAAGGAGTCGTTAACTCGAGTTAACGACTCCTTCTGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-635s21c1
Sequence:CCGGTTTGGCCTGGCTCACGAAATACTCGAGTATTTCGTGAGCCAGGCCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010019.3-1597s21c1
Sequence:CCGGCCTGTCAAGCTCGTGAGTAAACTCGAGTTTACTCACGAGCTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-811s1c1
Sequence:CCGGGCTGTGAGTTACGACTTTGATCTCGAGATCAAAGTCGTAACTCACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-552s1c1
Sequence:CCGGCATCATGTTGTTAGACAAGAACTCGAGTTCTTGTCTAACAACATGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-661s1c1
Sequence:CCGGCCTGAATTTGTTGCTCCAGAACTCGAGTTCTGGAGCAACAAATTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-987s1c1
Sequence:CCGGCGTGGTCAACCTGGAGAATTTCTCGAGAAATTCTCCAGGTTGACCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-468s1c1
Sequence:CCGGCACCAGCTTCATTAAGCAGATCTCGAGATCTGCTTAATGAAGCTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010019
DAPK2 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-465s21c1
Sequence:CCGGTGGCCCAGAAGGAGTCGTTAACTCGAGTTAACGACTCCTTCTGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-635s21c1
Sequence:CCGGTTTGGCCTGGCTCACGAAATACTCGAGTATTTCGTGAGCCAGGCCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010019.3-1597s21c1
Sequence:CCGGCCTGTCAAGCTCGTGAGTAAACTCGAGTTTACTCACGAGCTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-811s1c1
Sequence:CCGGGCTGTGAGTTACGACTTTGATCTCGAGATCAAAGTCGTAACTCACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-552s1c1
Sequence:CCGGCATCATGTTGTTAGACAAGAACTCGAGTTCTTGTCTAACAACATGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-661s1c1
Sequence:CCGGCCTGAATTTGTTGCTCCAGAACTCGAGTTCTGGAGCAACAAATTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-987s1c1
Sequence:CCGGCGTGGTCAACCTGGAGAATTTCTCGAGAAATTCTCCAGGTTGACCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-468s1c1
Sequence:CCGGCACCAGCTTCATTAAGCAGATCTCGAGATCTGCTTAATGAAGCTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010019
DAPK2 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-465s21c1
Sequence:CCGGTGGCCCAGAAGGAGTCGTTAACTCGAGTTAACGACTCCTTCTGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010019.3-635s21c1
Sequence:CCGGTTTGGCCTGGCTCACGAAATACTCGAGTATTTCGTGAGCCAGGCCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010019.3-1597s21c1
Sequence:CCGGCCTGTCAAGCTCGTGAGTAAACTCGAGTTTACTCACGAGCTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-811s1c1
Sequence:CCGGGCTGTGAGTTACGACTTTGATCTCGAGATCAAAGTCGTAACTCACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-552s1c1
Sequence:CCGGCATCATGTTGTTAGACAAGAACTCGAGTTCTTGTCTAACAACATGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-661s1c1
Sequence:CCGGCCTGAATTTGTTGCTCCAGAACTCGAGTTCTGGAGCAACAAATTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-987s1c1
Sequence:CCGGCGTGGTCAACCTGGAGAATTTCTCGAGAAATTCTCCAGGTTGACCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010019.2-468s1c1
Sequence:CCGGCACCAGCTTCATTAAGCAGATCTCGAGATCTGCTTAATGAAGCTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014326
VALIDATED
DAPK2 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-728s21c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-759s21c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-557s21c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-1735s1c1
Sequence:CCGGTACCTGATGCTTGGCTTCTTTCTCGAGAAAGAAGCCAAGCATCAGGTATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-675s1c1
Sequence:CCGGTCATCACCTACATCCTCTTAACTCGAGTTAAGAGGATGTAGGTGATGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-759s1c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-557s1c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-1243s1c1
Sequence:CCGGCCTGAGCACTTTGCAAGAGAGCTCGAGCTCTCTTGCAAAGTGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-566s1c1
Sequence:CCGGGAAGATGGAGTTGAATTTAAGCTCGAGCTTAAATTCAACTCCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-524s1c1
Sequence:CCGGCCACACATCAAGCTGATTGACCTCGAGGTCAATCAGCTTGATGTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-728s1c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014326
VALIDATED
DAPK2 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-728s21c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-759s21c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-557s21c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-1735s1c1
Sequence:CCGGTACCTGATGCTTGGCTTCTTTCTCGAGAAAGAAGCCAAGCATCAGGTATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-675s1c1
Sequence:CCGGTCATCACCTACATCCTCTTAACTCGAGTTAAGAGGATGTAGGTGATGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-759s1c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-557s1c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-1243s1c1
Sequence:CCGGCCTGAGCACTTTGCAAGAGAGCTCGAGCTCTCTTGCAAAGTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-566s1c1
Sequence:CCGGGAAGATGGAGTTGAATTTAAGCTCGAGCTTAAATTCAACTCCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-524s1c1
Sequence:CCGGCCACACATCAAGCTGATTGACCTCGAGGTCAATCAGCTTGATGTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-728s1c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014326
VALIDATED
DAPK2 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-728s21c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-759s21c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014326.3-557s21c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-1735s1c1
Sequence:CCGGTACCTGATGCTTGGCTTCTTTCTCGAGAAAGAAGCCAAGCATCAGGTATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-675s1c1
Sequence:CCGGTCATCACCTACATCCTCTTAACTCGAGTTAAGAGGATGTAGGTGATGATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-759s1c1
Sequence:CCGGGTTACGACTTTGATGAGGAATCTCGAGATTCCTCATCAAAGTCGTAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014326.x-557s1c1
Sequence:CCGGCACGAAATAGAAGATGGAGTTCTCGAGAACTCCATCTTCTATTTCGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199968    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-1243s1c1
Sequence:CCGGCCTGAGCACTTTGCAAGAGAGCTCGAGCTCTCTTGCAAAGTGCTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014326.3-566s1c1
Sequence:CCGGGAAGATGGAGTTGAATTTAAGCTCGAGCTTAAATTCAACTCCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-524s1c1
Sequence:CCGGCCACACATCAAGCTGATTGACCTCGAGGTCAATCAGCTTGATGTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014326.3-728s1c1
Sequence:CCGGCAGGAAACACTGGCAAATATCCTCGAGGATATTTGCCAGTGTTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)