EMAIL THIS PAGE TO A FRIEND

DAPK3

death-associated protein kinase 3

Synonyms: ZIP ZIPK
UniProtKB ID: O43293, A0AVN4, B3KQE2, Q05JY4
Gene ID:
Human(1613) Summary: Death-associated protein kinase 3 (DAPK3) induces morphological changes in apoptosis when overexpressed in mammalian cells. These results suggest that DAPK3 may play a role in the induction of apoptosis. [provided by RefSeq, Jul 2008]
Mouse(13144) death-associated protein kinase 3
Rat(64391) death-associated protein kinase 3
sheep(101114352) death-associated protein kinase 3
domestic guinea pig(100730226) death-associated protein kinase 3
naked mole-rat(101716355) death-associated protein kinase 3
Zebrafish(562194) death-associated protein kinase 3
cow(525506) death-associated protein kinase 3
Horse(100061244) death-associated protein kinase 3
domestic cat(101099780) death-associated protein kinase 3
dog(476745) death-associated protein kinase 3
chicken(101748881) death-associated protein kinase 3
chicken(101665103) death-associated protein kinase 3
chicken(428342) death-associated protein kinase 3
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001348 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001348 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001348 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001348 siRNAs that have been validated in the lab human pricing
NM_022546 Rosetta Predictions rat pricing
NM_007828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001348 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020912 validated 328
2 SASI_Hs01_00020910 predicted 647
3 SASI_Hs01_00020911 predicted 1343
4 SASI_Hs01_00020913 predicted 1776
5 SASI_Hs01_00020914 predicted 989
6 SASI_Hs01_00020915 predicted 1369
7 SASI_Hs01_00020916 predicted 1253
8 SASI_Hs02_00331677 predicted 730
9 SASI_Hs01_00020918 predicted 1053
10 SASI_Hs01_00020919 predicted 500
11 SASI_Hs01_00020917 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022546 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060198 predicted 455
2 SASI_Rn01_00060199 predicted 621
3 SASI_Rn01_00060200 predicted 660
4 SASI_Rn01_00060201 predicted 534
5 SASI_Rn01_00060202 predicted 791
6 SASI_Rn01_00060203 predicted 572
7 SASI_Rn01_00060204 predicted 298
8 SASI_Rn02_00263321 predicted 775
9 SASI_Rn01_00060205 predicted 349
10 SASI_Rn01_00060206 predicted 791
11 SASI_Rn01_00060207 predicted 673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058585 predicted 471
2 SASI_Mm01_00058586 predicted 432
3 SASI_Mm01_00058587 predicted 194
4 SASI_Mm01_00058589 predicted 671
5 SASI_Mm01_00058590 predicted 928
6 SASI_Mm01_00058591 predicted 684
7 SASI_Mm01_00058592 predicted 489
8 SASI_Mm01_00058593 predicted 793
9 SASI_Mm02_00312562 predicted 535
10 SASI_Mm01_00058594 predicted 266
11 SASI_Mm01_00058588 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001348
VALIDATED
DAPK3 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 3
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-330s1c1
Sequence:CCGGGCACGACATCTTCGAGAACAACTCGAGTTGTTCTCGAAGATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-286s1c1
Sequence:CCGGGTGAACATCCTGCGGGAGATCCTCGAGGATCTCCCGCAGGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-871s1c1
Sequence:CCGGCCCAAGCGGAGAATGACCATTCTCGAGAATGGTCATTCTCCGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-994s1c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-471s1c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-1365s1c1
Sequence:CCGGCAAGCAAGTAGCCTCCGAGATCTCGAGATCTCGGAGGCTACTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-653s1c1
Sequence:CCGGAGATTGTGAACTATGAGCCGCCTCGAGGCGGCTCATAGTTCACAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-999s1c1
Sequence:CCGGGAAGGAGTACACCATCAAGTCCTCGAGGACTTGATGGTGTACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-495s1c1
Sequence:CCGGCATCGCACACTTTGACCTGAACTCGAGTTCAGGTCAAAGTGTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-552s1c1
Sequence:CCGGCAACCCACGAATCAAGCTCATCTCGAGATGAGCTTGATTCGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001348.1-1814s21c1
Sequence:CCGGCGGGTAGTTGCACGGACAATTCTCGAGAATTGTCCGTGCAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-398s21c1
Sequence:CCGGTTGACTTCCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-700s21c1
Sequence:CCGGATCGGTGTCATCACCTATATCCTCGAGGATATAGGTGATGACACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-329s21c1
Sequence:GTACCGGTGCACGACATCTTCGAGAACACTCGAGTGTTCTCGAAGATGTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-471s21c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-994s21c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-796s21c1
Sequence:GTACCGGGACTTCGACGAGGAGTACTTCCTCGAGGAAGTACTCCTCGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001348
VALIDATED
DAPK3 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 3
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-330s1c1
Sequence:CCGGGCACGACATCTTCGAGAACAACTCGAGTTGTTCTCGAAGATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-286s1c1
Sequence:CCGGGTGAACATCCTGCGGGAGATCCTCGAGGATCTCCCGCAGGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-871s1c1
Sequence:CCGGCCCAAGCGGAGAATGACCATTCTCGAGAATGGTCATTCTCCGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-994s1c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-471s1c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-1365s1c1
Sequence:CCGGCAAGCAAGTAGCCTCCGAGATCTCGAGATCTCGGAGGCTACTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-653s1c1
Sequence:CCGGAGATTGTGAACTATGAGCCGCCTCGAGGCGGCTCATAGTTCACAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-999s1c1
Sequence:CCGGGAAGGAGTACACCATCAAGTCCTCGAGGACTTGATGGTGTACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-495s1c1
Sequence:CCGGCATCGCACACTTTGACCTGAACTCGAGTTCAGGTCAAAGTGTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-552s1c1
Sequence:CCGGCAACCCACGAATCAAGCTCATCTCGAGATGAGCTTGATTCGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001348.1-1814s21c1
Sequence:CCGGCGGGTAGTTGCACGGACAATTCTCGAGAATTGTCCGTGCAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-398s21c1
Sequence:CCGGTTGACTTCCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-700s21c1
Sequence:CCGGATCGGTGTCATCACCTATATCCTCGAGGATATAGGTGATGACACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-329s21c1
Sequence:GTACCGGTGCACGACATCTTCGAGAACACTCGAGTGTTCTCGAAGATGTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-471s21c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-994s21c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-796s21c1
Sequence:GTACCGGGACTTCGACGAGGAGTACTTCCTCGAGGAAGTACTCCTCGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001348
VALIDATED
DAPK3 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 3
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199874    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-330s1c1
Sequence:CCGGGCACGACATCTTCGAGAACAACTCGAGTTGTTCTCGAAGATGTCGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199436    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001348.1-286s1c1
Sequence:CCGGGTGAACATCCTGCGGGAGATCCTCGAGGATCTCCCGCAGGATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-871s1c1
Sequence:CCGGCCCAAGCGGAGAATGACCATTCTCGAGAATGGTCATTCTCCGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-994s1c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-471s1c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-1365s1c1
Sequence:CCGGCAAGCAAGTAGCCTCCGAGATCTCGAGATCTCGGAGGCTACTTGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-653s1c1
Sequence:CCGGAGATTGTGAACTATGAGCCGCCTCGAGGCGGCTCATAGTTCACAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001348.x-999s1c1
Sequence:CCGGGAAGGAGTACACCATCAAGTCCTCGAGGACTTGATGGTGTACTCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-495s1c1
Sequence:CCGGCATCGCACACTTTGACCTGAACTCGAGTTCAGGTCAAAGTGTGCGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001348.x-552s1c1
Sequence:CCGGCAACCCACGAATCAAGCTCATCTCGAGATGAGCTTGATTCGTGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320487    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001348.1-1814s21c1
Sequence:CCGGCGGGTAGTTGCACGGACAATTCTCGAGAATTGTCCGTGCAACTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-398s21c1
Sequence:CCGGTTGACTTCCTGGCGGAGAAAGCTCGAGCTTTCTCCGCCAGGAAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-700s21c1
Sequence:CCGGATCGGTGTCATCACCTATATCCTCGAGGATATAGGTGATGACACCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-329s21c1
Sequence:GTACCGGTGCACGACATCTTCGAGAACACTCGAGTGTTCTCGAAGATGTCGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-471s21c1
Sequence:CCGGCGTTCACTACCTGCACTCTAACTCGAGTTAGAGTGCAGGTAGTGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-994s21c1
Sequence:CCGGCGTCTGAAGGAGTACACCATCCTCGAGGATGGTGTACTCCTTCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001348.1-796s21c1
Sequence:GTACCGGGACTTCGACGAGGAGTACTTCCTCGAGGAAGTACTCCTCGTCGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007828
VALIDATED
DAPK3 MISSION shRNA Bacterial Glycerol Stock
death-associated protein kinase 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-229s1c1
Sequence:CCGGCCCAACATCATAACACTGCATCTCGAGATGCAGTGTTATGATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-475s1c1
Sequence:CCGGCGCATTAAGCTCATCGACTTTCTCGAGAAAGTCGATGAGCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-356s1c1
Sequence:CCGGCCACGCAGTTCCTCAAACAAACTCGAGTTTGTTTGAGGAACTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-246s1c1
Sequence:CCGGGCATGACGTGTTCGAGAACAACTCGAGTTGTTCTCGAACACGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-700s1c1
Sequence:CCGGGCAGTGAACTATGACTTTGATCTCGAGATCAAAGTCATAGTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007828.1-312s21c1
Sequence:CCGGTTTCGACTTCCTGGCCGAGAACTCGAGTTCTCGGCCAGGAAGTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007828
VALIDATED
DAPK3 MISSION shRNA shRNA Plasmid DNA
death-associated protein kinase 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-229s1c1
Sequence:CCGGCCCAACATCATAACACTGCATCTCGAGATGCAGTGTTATGATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-475s1c1
Sequence:CCGGCGCATTAAGCTCATCGACTTTCTCGAGAAAGTCGATGAGCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-356s1c1
Sequence:CCGGCCACGCAGTTCCTCAAACAAACTCGAGTTTGTTTGAGGAACTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-246s1c1
Sequence:CCGGGCATGACGTGTTCGAGAACAACTCGAGTTGTTCTCGAACACGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-700s1c1
Sequence:CCGGGCAGTGAACTATGACTTTGATCTCGAGATCAAAGTCATAGTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007828.1-312s21c1
Sequence:CCGGTTTCGACTTCCTGGCCGAGAACTCGAGTTCTCGGCCAGGAAGTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007828
VALIDATED
DAPK3 MISSION shRNA Lentiviral Transduction Particles
death-associated protein kinase 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-229s1c1
Sequence:CCGGCCCAACATCATAACACTGCATCTCGAGATGCAGTGTTATGATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-475s1c1
Sequence:CCGGCGCATTAAGCTCATCGACTTTCTCGAGAAAGTCGATGAGCTTAATGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-356s1c1
Sequence:CCGGCCACGCAGTTCCTCAAACAAACTCGAGTTTGTTTGAGGAACTGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007828.1-246s1c1
Sequence:CCGGGCATGACGTGTTCGAGAACAACTCGAGTTGTTCTCGAACACGTCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007828.1-700s1c1
Sequence:CCGGGCAGTGAACTATGACTTTGATCTCGAGATCAAAGTCATAGTTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007828.1-312s21c1
Sequence:CCGGTTTCGACTTCCTGGCCGAGAACTCGAGTTCTCGGCCAGGAAGTCGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks